Skip to main content
Addgene
Showing: 31 - 60 of 836 results
  1. Plasmid Cloning by Restriction Enzyme Digest (with Protocols)

    Type
    Protocol
    ...restriction sites that are also present in the same orientation on your target vector. If you are not sure what...Will result in your insert being in the correct orientation in the recipient plasmid. (You don't want to ...verify that the insert was cloned in the correct orientation. If you cannot find enzymes that meet these criteria...flank your insert and will result in correct orientation in the recipient plasmid, it is useful to see...compatible overhangs you will need to verify the orientation of your insert, so you may want to design a diagnostic...
  2. Coomassie Purity Stain of Recombinant Antibodies

    Type
    Protocol
    ...instructions if you are unsure of the correct orientation of the gel. Carefully remove the comb from the...gel with deionized water for 5 min with gentle agitation on a rocking platform. Pour off the water in the...SimplyBlue SafeStain and incubate for 1 h with gentle agitation on a rocking platform. Pour off the SimplyBlue...deionized water and incubate for 1 h with gentle agitation on a rocking platform. Pour off the water in the...
  3. Four Base Editing Reporters to Monitor and Enrich Editing in Real-time

    Type
    Blog Post
    ...by a ‘CAC’ codon that is converted to a ‘TAC’ or ‘TAT’ after a C-to-T base editing event. This edit changes...Base editors create specific point mutations in the genome, but they’re inefficient compared to CRISPR... is a bicistronic construct that consists of a mutated mCherry and a downstream constitutively active ...the eGFP reporters the Harris lab individually mutated three codons in eGFP to eliminate fluorescence....eGFP reporters rely on the correction of point mutations in eGFP that results in the restoration of fluorescence...GFP construct, that contains an ACG start codon mutation, and integrated it into human and mouse cells ...events in vivo. As GO relies on the correction of a mutated start codon to initiate protein expression, it ...
  4. Protocol - How to Perform Sequence Analysis

    Type
    Protocol
    ...mismatch/mutation may be the result of a mis-called peak in the trace file. If the mutation is not an...such as the gene/insert, fusion proteins, point mutations, deletions, etc.) involves selecting one or more...Addgene sequences the plasmid to verify tags, mutations and a portion of the insert, but we do not sequence...
  5. CRISPR Library Amplification

    Type
    Protocol
    ...and plasmid recombination can all impact the representation of individual plasmids in the pooled library...individual libraries may require modifications dictated by the originating laboratory for optimal results...adequate NGS based QC to ensure no change in representation compared to the pre-amplified stock. A last...note that NGS should be performed to ensure representation is maintained. Maxipreps - Less is more: Do...
  6. Viral Vectors 101: Integrase-Deficient Lentiviral Vectors

    Type
    Blog Post
    ...The packaging plasmid contains Gag, Pol, Rev, and Tat genes. Specifically for our knowledge here, the Pol...by long terminal repeat (LTR) sequences, which facilitate integration of this portion into the host genome...vesicular stomatitis virus G protein (VSV-G), which facilitates viral entry into the host cell.  Transfecting...(see Figure 2).  Figure 2: Schematic representation of integration process and episomal forms of...Addgene: psPAX2-D64V. This construct has the D64V mutation, a single amino acid change (from aspartic acid...detecting vector particle components or performing quantitative PCR titration of vector DNA in samples harvested...Insertional mutagenesis combined with acquired somatic mutations causes leukemogenesis following gene therapy of...
  7. Centrifugation

    Type
    Protocol
    ...that can hold larger containers, but they can also rotate at much higher speeds and are used for more specialized...balanced. Using the centrifuge in an unbalanced state can damage the centrifuge and be dangerous for the...
  8. Lab Safety for Biosafety Levels One and Two

    Type
    Protocol
    ...contact with hazardous materials. A sink, eyewash station, safety shower, fire blanket, and extinguisher ... are located before you start. Use the eyewash station if unwanted or biohazardous materials are splashed...
  9. TALENs for Endogenous Zebrafish Genes

    Type
    Collection
    ...TGCAGAGGCTAAAGCGTTcgctgtccttcaagacCAAGAGTCTTCGCAGCAA Stat3 TAL3560 & TAL3561 TGCAGCAGTTGGAGACGCggtatctggagcagctGTATCACCTGTACAGCGA stxbp1a TAL3562...engineered TALENs can be used to induce targeted mutations with high efficiency in zebrafish ( Sander et ...TGATCTGGATCCTAACAAggatgacttgcccctgtGTGCGAACACCAACCATA arf6 TAL3212 & TAL3213 TGGGGAAGATGCTTTCCAagatcttcggcaacaaGGAGATGAGAATATTGA arnt1 TAL3214 & TAL3215 TCCCGTCTCTGGCCATGAcctcctctaatggatcTCATTCCAACGGTGTGCA...TCAGCTCCCCGGAGAGGCaccgcactgctccagggTTGGATGATGGACATGGA bsx TAL3034 & TAL3035 TCTCAGACTCACAGTTATccggactcgagaaaagGTTCGAGATCCAGAGATA btr30 TAL3036 & TAL3037 ...casp8ap2 TAL3038 & TAL3039 TATAACAAATCCCACCACattgcccgatatcttgAATACTTCCAAAACAAAA Ccl2 TAL3222 & TAL3223 TTTTCGTTTTCCACTATAaagatcccagttaagcAGGTTCAGAGTTATCATA... TTTTCGTTTTCCACTATAaagatcccagttaagcAGGTTCAGAGTTATCATA cebpa TAL3040 & TAL3041 TATTCCACAACAGCTCCAagcaagagaagctcaaACTGGCGAGCGGAGACTA...TTCTCAAAATGAGAGGGGtgaatctgaagttcaaCAAACCCAGCAGCACCAA CIT1 TAL3226 & TAL3227 TGAAGTTTAAATATGGAGgtcatggcagtgttaaAGATCTGTCCGCAGTCGA cited2 TAL3228 & TAL3229...
  10. Protocol - How to Ligate Plasmid DNA

    Type
    Protocol
    ...that the insert will be added in the correct orientation and prevents the vector from ligating to itself...indicates the various controls: Control Ligase Interpretation Uncut vector - Checks viability of competent...
  11. Validated gRNA Sequences

    Type
    Collection
    ...Addgene's Datatable of validated gRNA sequences....validated for use in CRISPR experiments. This datatable is compiled from plasmids in Addgene's database...designed to accomplish. Validated gRNA Sequence Datatable Target Gene Target Species Target Sequence Plasmid...pyogenes 25739462 Jiang ade6-L469 S. pombe TCTATTGTTCAGATGCCTTG 52227 cut S. pyogenes 25352017 Zaratiegui...Zaratiegui ade6-M210 S. pombe TCTATTGTTCAGATGCTTCG 52226 cut S. pyogenes 25352017 Zaratiegui ade6+ S. pombe TCTATTGTTCAGATGCCTCG... TCTATTGTTCAGATGCCTCG 52225 cut S. pyogenes 25352017 Zaratiegui Alk and Eml M. musculus 64071 cut S. pyogenes...25337876 Ventura Amplicon, JAK2 H. sapiens GAGGCATATTCTTCTCCTGG 70660 cut S. pyogenes 26472758 Sabatini ...
  12. Rett Syndrome

    Type
    Collection
    ...caused from loss-of-function mutations in the MECP2 gene. Causative mutations for Rett syndrome typically...within patients with the same mutation, the location and type of MECP2 mutation can be a strong predictor ...missense mutations located in the MBD, and truncations prior to the NID are more severe than mutations further...to their laboratory website. Cell Line Mutation (DNA) Mutation (protein) Sex Source of Material Publication...species (mouse or human) Mutation ID Plasmid Description Gene/Insert Mutations PI Return to top External...meet diagnostic criteria have disease-causing mutations in the gene methyl-CpG binding protein 2 ( MECP2...erminal D omain (CTD) The most common missense mutations cluster in the MBD and NID demonstrating the importance...
  13. Pouring LB Agar Plates

    Type
    Protocol
    ...autoclave, you should prepare your plate pouring station: Find an empty section of lab bench with a working...thermometer. Light the flame at the plate pouring station and dilute your antibiotic into your ~60 ℃ molten...
  14. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Barros Lactate/Pyruvate Lapronic FRET-based sensor for Lactate/Pyruvate Ratio Imaging of the Lactate/Pyruvate...(4):525-531.e4. Dmytro Yushchenko Lactate Laconic FRET-based lactate sensor Barros Lab Laconic Plasmids...Felipe Barros Lactate Expresses eLACCO1.1 fluorescent biosensor for extracellular L-lactate, in neurons,...extracellular L-lactate. Nat Commun. 2021 Dec 6;12(1):7058. Marie-Eve Paquet , Robert Campbell Lactate Lindoblum... fluorescent biosensor for lactate Green fluorescent protein-based lactate and pyruvate indicators suitable... cytosolic NADH/NAD+ redox state Imaging Cytosolic NADH-NAD(+) Redox State with a Genetically Encoded ...Oct 23;9(10):e110600. Isei Tanida Electrostatic potential Quantitative measurements of membrane charges...
  15. Deisseroth INTRSECT Collection

    Type
    Collection
    ...recombinase-dependent: Excitatory Opsins Addgene ID Plasmid Logic Sites and Mutations In-Stock Viral Items...Collection INTRSECT Plasmid Collection INTRSECT Implementation Plasmids References The development of powerful...producing a functional molecular tool (C,F). Implementation The following resources may be of interest ...developed, including additional fluorophores, excitatory and inhibitory opsins , genetically-encoded calcium...Recombinases Addgene ID Plasmid Logic Sites and Mutations In-Stock Viral Items 55636 pAAV-EF1a-Cre None ...-dependent Addgene ID Plasmid Logic Sites and Mutations In-Stock Viral Items 55641 pAAV-Ef1a-fDIO EYFP...Fluorophores Addgene ID Plasmid Logic Sites and Mutations In-Stock Viral Items 55650 pAAV-hSyn Con/Fon EYFP...
  16. Zhang Lab's CRISPR Frequently Asked Questions

    Type
    Collection
    ...span the knock-in gene. For making mutations, one good way is to mutate the PAM 'NGG' sequence in the HR...a silent mutation. When attempting to use the CRISPR/Cas9 system to create specific mutations or insertions...possible. For introducing small mutations (<50bp) or a single-point mutation, the best HR template for transfection...the introduction of a mutation into the genome, how can cells with that mutation be selected/screened?...on each side flanking your desired insertion or mutation. Each arms is around 800bp. For transfection in...the HR template, you usually would need to make mutations of the HR template to avoid this donor plasmid...being degraded by Cas9 in cells. One good way is to mutate the PAM 'NGG' in the HR template, like change it...
  17. CRISPR Guide

    Type
    Collection
    ...developed by mutating specific amino acid residues to reduce off-target editing. Some mutations disrupt interactions...off-target mutations in DNA, RNA, or both, and are recommended in contexts where such mutations would be...target DNA. Once the Cas9-gRNA complex binds a putative DNA target, the seed sequence (8–10 bases at the... and a gRNA will result in a diverse array of mutations (see: Validate genetic modification ). In most...amino acid deletions, insertions, or frameshift mutations leading to premature stop codons within the open...targeted gene. The ideal result is a loss-of-function mutation within the targeted gene. However, the strength...Catalytically inactive “dead” Cas9 (dCas9) contains mutations in both nuclease domains, D10A and H840A, resulting...
  18. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...contain the A206K mutation are monomeric at all concentrations, so this is mutation is noted when present....g. off to on) Excitation and Emission wavelengths after activation. Protein Excitation (nm) Emission ... Fusions (Organized by Color) For each table: Excitation and Emission maximum are listed in nm. Brightness...Structure describes the monomeric or oligomeric state of the protein. Many FPs are monomers at low concentration...Photoconvertible Photoswitchable Timers Blue/UV Protein Excitation (nm) Emission (nm) Brightness pKa Maturation ...Bacterial Expression Jump to Top Cyan Protein Excitation (nm) Emission (nm) Brightness pKa Maturation ...Bacterial Expression Jump to Top Green Protein Excitation (nm) Emission (nm) Brightness pKa Maturation ...
  19. AAV Production in HEK293 Cells

    Type
    Protocol
    ...for 3 h without stirring to allow full precipitation. Precipitation of the viruses can proceed overnight...
  20. Plan Your Experiment

    Type
    Collection
    ...Furthermore, in cells containing two mutated alleles, each mutated allele may be different owing to the...Provides a semi-quantitative readout of the percentage of alleles that have been mutated within a mixed... type or organism without a specific preferred mutation Cas9 (or Cas9 nickase) Single (or dual) gRNA targeting...increases specificity but is less efficient. Each putative knockout allele must be experimentally verified... a particular gene, such as generating a point mutation or inserting a tag Cas9 (or Cas9 nickase); Base...knockout. Base editors can make a limited set of mutations. Repress or Interfere (CRISPRi) Reduce expression... the N-terminus are targeted since frameshift mutations here increase the likelihood that a nonfunctional...
  21. University of Florida Serotype Testing Panel for the Eye and Brain

    Type
    Collection
    ...71. PMID: 19066593 Other citations include: Bogner, et al. 2015. Capsid Mutated Adeno-Associated Virus ...References for each serotype can be found below under Citations. AAV2(Y444F) The AAV2(Y444F) serotype is demonstrated...from the AAV2 capsid and contains the following mutations: Y444F, Y500F, and Y730F. AAV2(4pMut)dHS The AAV2...It is derived from AAV2 and has the following mutations: Y444F, Y500F, Y730F, T491V, R487G, R585S, and...from the AAV6 capsid and contains the following mutations: Y705F, Y731F and T492V. AAV44.9 The AAV44.9 serotype...Beta actin (CBA) GFP Control Sergei Zolotukhin Citation Information AAV2(Y444F) When using the AAV2(Y444F...Ther . Feb;19(2):293-301. PMID: 21045809 Other citations include: Chen, et al. 2014. Reprogramming adipose...
  22. p53 Pathway

    Type
    Collection
    ...frequently mutated gene (>50%) in human cancer; most of these mutations are missense mutations in the DNA-binding...regulator; also known as MDM4 Noxa Phorbol-12-myristate-13-acetate-induced protein 1; also known as PMAIP1 ...19776742 . Germline TP53 mutations and Li-Fraumeni syndrome. Varley JM. Hum Mutat. 2003 Mar;21(3):313-20..., often at one of six hotspot residues. These mutations can be inherited or arise through exposure to ... (e.g., HPV, the human papillomavirus). These mutations interfere with p53’s ability to activate transcription...Li-Fraumeni syndrome. Recently some impacts of p53 mutations have been characterized as gain-of-function, expanding...;415(6867):45-53. PubMed PMID: 11780111 . p53 mutations in human cancers. Hollstein M, Sidransky D, Vogelstein...
  23. Antibody Guide

    Type
    Collection
    ...protein complexes. Includes: Immunoprecipitation (IP) Chromatin immunoprecipitation (ChIP) Visualization - ...Capture methods such as immunoprecipitation (IP) and chromatin immunoprecipitation (ChIP) allow you to isolate...which emit a specific wavelength of light after excitation by light of a specific wavelength. While more...interactions in a specific timeframe or context. Immunoprecipitation (IP) IP uses immobilized antibodies to isolate... on the same general strategy. Figure 5: Immunoprecipitation using bead-based antibody capture to isolate...isolating protein from serums. Chromatin immunoprecipitation (ChIP) This variation of IP uses antibodies...for individual assays. Clear cell debris by sedimentation. Proceed with IP using a primary antibody for...
  24. Luciferase Plasmid Collection

    Type
    Collection
    ...method for the systematic and quantitative analysis of co-immunoprecipitations using both Renilla and Firefly...luminescence-based co-immunoprecipitation to assess protein-protein interactions. NanoLuc® complementation : Protein-protein...enhancers and untranslated regions, or the effect of mutations of these regulatory elements on gene expression...a convenient toolkit to assess the proteostasis status in a wide range of experimental systems. LumiLuc... DULIP ( DU al L uminescence-based C o- I mmunoprecipitation) plasmids : Luminescence-based protein-protein...more. nLuc/cLuc for split Firefly Luciferase complementation in plants. Bioluminescence Resonance Energy...Firefly Insertion of 5' promoter/enhancer regions. Mutations within the luciferase gene allow for increased...
  25. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...promoter forward primer: CGTAACTTGAAAGTATTTCGATTTCTTGGC. This is a representative sequencing primer; other...2001. PubMed . MicroRNA detection in prostate tumors by quantitative real-time PCR (qPCR). Gordanpour...the full-text of the publication here . Article Citation Generation of Genomic Deletions in Mammalian Cell...alleles 2 , which are likely to cause frameshift mutations leading to nonsense mediated decay of the mRNA...2A ). However, DSB will occur independent of orientation of the protospacer sequence/PAM relative to the...samples on 2% agarose gel at 10 V/cm using 1x Tris-acetate-EDTA (TAE) buffer. Examine samples for the presence... per well for a final volume of 150 μl. This facilitates screening by allowing a multichannel pipette ...
  26. Fujii Lab CRISPR Plasmids

    Type
    Collection
    ...technologies consist of insertional chromatin immunoprecipitation (iChIP) and engineered DNA-binding molecule-mediated...molecule-mediated chromatin immunoprecipitation (enChIP; Fujita & Fujii, 2013). In iChIP, specific genomic... proteins of EPAS1 identified by enChIP-MS - A putative role of HDX as a negative regulator. Hamidian ... DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) using CRISPR. Fujita T, Fujii H.... DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP). Fujita T, Asano Y, Ohtsuka J, Takada...insulator components by insertional chromatin immunoprecipitation. Fujita T, Fujii H. PLoS One. 2011;6(10):....0026109. PubMed . Insertional chromatin immunoprecipitation: a method for isolating specific genomic ...
  27. TALEN Guide

    Type
    Collection
    ...correcting a typo in the latest draft of your dissertation. Well, that will probably never happen. Yet ... to this DNA targeting ideal. Figure 1: (A) Representation of a zinc finger (ZF) nuclease. Zinc fingers...for molecular tools. ZFs are not without their limitations, however. Not every nucleotide triplet has a ...Martin-Luther-University Halle-Wittenberg and Adam Bogdanove at Iowa State University published the nucleotide recognition ...if not slightly lower. Figure 2: Simplified representation of the Voytas/Bogdanove Golden Gate TALEN kit...in a C. elegans lab and have been struggling to mutate a specific gene or your anxiously investigating...
  28. TALEN Plasmids and Kits

    Type
    Collection
    ...TALEN Guide. These collections and accompanying documentation allow one to efficiently assemble TALEN constructs...truncated at both the N and C terminus and induces mutation at rates much higher than the parental vectors...generation architecture has been shown to increase mutation induction when using TALENs. The FokI domains ...homodimeric or enhanced heterodimeric (ELD, KKR mutations) FokI domains. 40131 pCAG-T7-TALEN(Sangamo)-FokI-KKR-Destination...are designed to target and edit the epigenome of putative enhancers in mammalian cells. These plasmids allow...suitable for the TALEN-based generation of germline mutations in Bombyx mori and Drosophila melanogaster . Zhang...
  29. Immunology Research Plasmids and Resources

    Type
    Collection
    ...MGC110940, OPN SST somatostatin SMST SSTR1 somatostatin receptor 1 SRIF-2 SSTR2 somatostatin receptor 2 - SSTR5...arginine-rich, mutated in early stage tumors ARP, MANF, MGC142148, MGC142150 ARMETL1 arginine-rich, mutated in early...GHRFR, GHRHRpsv, GRFR GHRL ghrelin/obestatin prepropeptide MTLRP, obestatin GHSR growth hormone secretagogue...growth inhibitor 1 BDGI, OKL38 OSM oncostatin M MGC20461 OSMR oncostatin M receptor MGC150626, MGC150627,...have plasmids available for request. Antigen Presentation The cornerstone of the immune response is the...including dendritic cells and macrophages. Antigen presentation is mediated by the MHC class I and class II ...available for request. Antigen Processing and Presentation The cornerstone of the immune response is the...
  30. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...host organism. Host Relevant Promoters Representative Empty Backbones Mammalian CMV, SV40, EF1a, ...could allow you to conduct western blots or immunoprecipitations of your favorite gene even if you do...Tag or Fusion Protein Common uses Representative Empty Backbones Flag Epitope tag... Marker Typical Host Organism Representative Empty Backbones Neomycin (G418) ...methods: Delivery method Advantages Representative Empty Backbones Lentiviral Can transduce...and genome modification Element Details Representative Empty Backbones Promoter Measure...
Showing: 31 - 60 of 836 results