We narrowed to 60 results for: &alpha

...promoters, including calmodulin-dependent kinase II alpha (aCaMKII; excitatory neurons) and Synapsin-1 (pan-neuronal...

...diseases. His spare time is spent trying to raise the alpha isoform of GSK-3 to the same (deserved) stature ...

...mammalian expression from human elongation factor 1 alpha Constitutive  Tends to give consistent expression...

... PPP1CA Protein phosphatase 1 catalytic subunit alpha PREX2 Phosphatidylinositol-3,4,5-trisphosphate-dependent... kinase AMP-activated: A1,A2: Catalytic subunit alpha B1,B2: non-catalytic subunit beta G1, G2, G3: non-catalytic...

...successfully generated several functional heterotrimeric G-alpha subunit fusions that do not tolerate N- and C-terminal...

...Transcriptional repression DNA Methyltransferase 3 Alpha (DNMT3A) Vlatka Zoldoš’ lab has deposited pdCas9...

...peptides (3HB: 11-nm 3-helix bundle; SAH: 60-nm single alpha helix) and target capture module (SpyTag-GFP nanobody...

... transduction efficiency in pancreatic beta and alpha cells utilizing various AAV serotypes. Scientific...

...catalytic and regulatory subunits - Class I PKC PKC alpha PKC beta PKC delta PKC epsilon PKC gamma PKC eta...

...-shRNA3 72598 Expresses shRNA against mouse TNF-alpha mRNA from the mouse U6 promoter pCDH-EF1-Nluc-P2A-copGFP-T2A-Puro...

...GADD45G Growth arrest and DNA-damage-inducible; alpha, beta, or gamma IGF-BP3 Insulin-like growth factor...

...Thorel, F., et al., Conversion of adult pancreatic alpha-cells to beta-cells after extreme beta-cell loss...

...Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC Alpha factor signal sequence Forward... Reverse XEF1a TTTCGCCCTAACTTCGTGAT Xenopus EF1 alpha enhancer/promoter Forward Xpress Forward TATGGCTAGCATGACTGGT...

...program, WVE-006, corrects the SERPINA1 Z mutation in alpha-1 antitrypsin deficiency (AATD) and is currently...

...al. Neuron. 2010) Express EGFP-tagged wt and mt Alpha-synuclein . (Furlong et al. Biochem J. 2000) See...

...coexpression. Didier Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression...into the plasmid. Garry Nolan 12257 pWPXL 2nd EF-1alpha-driven constitutive transgene expression. Contains...high expression. Didier Trono 12254 pWPI 2nd EF-1alpha driven constitutive transgene expression and EGFP...variants. Stephen Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-expression...

...NEB #M0202S T4 DNA ligase buffer NEB #B0202S DH5 alpha competent cells Invitrogen #18258-012 Qiaquick gel...Transform 2 μL of ligation mix into 25 μL competent DH5 alpha cells, following manufacturer’s protocol. Plate ...

... Strong promoter from human elongation factor 1 alpha PGK Constitutive Mammalian Promoter from phospholycerate...

...IgG2a 190302 Anti-Gs protein, alpha subunit [N192/12] Gs protein, alpha subunit Cow Mouse IgG2a 190303...Mouse Mouse IgG2a 206555 Anti-Alpha-2C adrenergic receptor [N330A/80R] Alpha-2C adrenergic receptor Human... Mouse 219492 Anti-Alpha-2C adrenergic receptor scFv [N330A/80 scFv] N330A/80 Alpha-2C Human Mouse 219493...-GABA(A)R, Alpha4 [N398A/34R] GABA(A)R, Alpha4 Rat Mouse IgG2a 177544 Anti-GABA(A)R, Alpha2 [N399/19R]...GABA(A)R, Alpha4 scFv [N398A/34] N398A/34 scFv GABA(A)R, Alpha4 Rat Mouse 190552 GABA(A)R, Alpha2 scFv [N399...Mouse IgG2a 128634 Anti-Slo1/BKAlpha maxi-K+ channel [L6/23R] Slo1/BKAlpha maxi-K+ channel Mouse Mouse ...Mouse IgG2a 149456 Anti-GABA(A)R, Alpha5 [N415/24R] GABA(A)R, Alpha5 Human Mouse IgG2a 149458 Anti-Cavbeta2...

...Rtn4a-GFP (tubular ER) Microtubules mCherry-alpha-tubulin Early Endosome Vacuolar Compartment...