We narrowed to 32 results for: 974
-
TypeBlog Post...116:27001–27010. https://doi.org/10.1073/pnas.1915974116 Guerin K, Rego M, Bourges D, Ersing I, Haery ...
-
FLEx Technology and Optogenetics: Flipping the switch on gene expression with high spatial and temporal resolution
TypeBlog Post...Scientific reports 8.1 (2018): 7321. PubMed PMID: 29743652. PubMed Central PMCID: PMC5943452. Abremski, Ken... -
Genetic Code Expansion
TypeCollection...Bacterial Ahmed Badran 209740 pAB228q12 TyrRS M. jannaschii Bacterial Ahmed Badran 209741 pAB228r3 Mlum1RS ...Bacterial Ahmed Badran 209742 pAB228p PylRS M. mazei Bacterial Ahmed Badran 209743 pAB228p4 PylRS M. mazei...Bacterial Ahmed Badran 209744 pAB228v TrpRS S. cerevisiae Bacterial Ahmed Badran 209745 pAB228v6 TrpRS S. .... cerevisiae Bacterial Ahmed Badran 209746 pAMC070n1a12 ScTrpRS, Lum1PylRS, MmPylRS S. cerevisiae, Lum1... -
Chemogenetics AAV Preps
TypeCollection...Sternson 119742 AAV SYN PSAM4 GlyR IRES EGFP PSAM4 GlyR - Inhibition IRES EGFP none 5 Sternson 119744 AAV ...Activation mCherry fusion Flp-dependent 8, rg* Gether 119741 AAV SYN flex PSAM4 GlyR IRES EGFP PSAM4 GlyR - ... -
Brain Initiative Collection
TypeCollection... the fluorescent protein eYFP Viviana Gradinaru 119741-AAV5 AAV SYN flex PSAM4 GlyR IRES EGFP Chemogenetics...Cre-dependent expression plasmid Scott Sternson 119741-AAV9 AAV SYN flex PSAM4 GlyR IRES EGFP Chemogenetics...Cre-dependent expression plasmid Scott Sternson 119742-AAV5 AAV SYN PSAM4 GlyR IRES EGFP Chemogenetics...Chemogenetics expression plasmid Scott Sternson 119744-AAV5 AAV CAMKII PSAM4 GlyR IRES EGFP Chemogenetics expression... -
Validated gRNA Sequences
TypeCollection...pyogenes 26997482 Yeo TFRC H. sapiens GCACUGACCAGAUAAGAAUG 74709 RNA targeting S. pyogenes 26997482 Yeo AAVS1...GATATTGTAGTCTATCGAGA 59928 cut S. pyogenes 25161212 Fire rde-1(H974) C. elegans GATAAATGAGCATAATGAAC 59929 cut S. pyogenes... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection...SON Nuclear speckles 159744 DMD-mEGFP AICSDP-55 mEGFP Dystrophin Costameres 159745 TFAM-mEGFP AICSDP-72... -
Arf GTPase Family
TypeCollection...64411 1544 Mammalian (pEGFP-C2) GAP Acap1 (CENTB1) 9744 740 Mammalian (pFLAG-CMV2) GAP Acap2 (CENTB2) 23527... -
Bacterial Expression Systems
TypeCollection...coli , Mycobacterium tuberculosis Vinay Nandicoori 188974 pREDusk-AmpR-MCS FixK2 Red light (660 nm) Escherichia... -
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection...BGHpA AiP15072 AiE0680m Cre Layer 2-3_IT Isocortex 223974 pAAV-AiE0050m_3xC2-minCMV-SYFP2-WPRE3-BGHpA AiP12211... -
Immunology Research Plasmids and Resources
TypeCollection...somatomedin A) C11orf43, FLJ22066, FLJ44734, INSIGF, pp9974 IGF2R insulin-like growth factor 2 receptor CD222...ECGF1, MNGIE, PDECGF, TP, hPD-ECGF UCN urocortin MGC129974, MGC129975, UI, UROC UCN2 urocortin 2 SRP, UCN-II... -
Neurodegeneration Plasmid Collection
TypeCollection...A232E)-EGFP VCP His, GFP, HA CMV ALS Nico Dantuma 23974 VCP(DK0)-EGFP VCP His, GFP, HA CMV ALS Nico Dantuma...pGEX-parkin F146A PRKN GST tac Parkinson's Kalle Gehring 45974 pGEX-parkin W403A PRKN GST tac Parkinson's Kalle...