Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 433 results for: Hal

Showing: 21 - 40 of 433 results

  1. Validated gRNA Sequences

    Type
    Collection
    ...26355004 Mendenhall CEBPB H. sapiens GCCGGCAGGGGGACGCGCGCGG 64047 tag S. pyogenes 26355004 Mendenhall Cent1...26355004 Mendenhall CREB1 H. sapiens GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes 26355004 Mendenhall csr-...26355004 Mendenhall GABPA H. sapiens TTTGGAGTCTCAGAATGTCCTGG 64255 tag S. pyogenes 26355004 Mendenhall GAL4... Kim BRI1 A. thaliana TTTGAAAGATGGAAGCGCGG cut S. pyogenes 26479191 Kim BRI1 A. thaliana TGAAACTAAACTGGTCCACA...TAGGAATCAAACACTTTTATTGG 64690 tag S. pyogenes 26355004 Mendenhall ATM H. sapiens TGAATTGGGATGCTGTTTTT 58779 cut... pyogenes 23792628 Joung ETC2, TRY, and CPC A. thaliana 71288 cut S. pyogenes 26193878 Chen FANCF H. sapiens... 49772 cut S. pyogenes 24112467 Kamoun PDS3 A. thaliana GGACTTTTGCCAGCCATGGT 52255 cut S. pyogenes 23929339...

  2. Biosensor AAV Preps

    Type
    Collection
    ...Campbell Calcium Sensor: HaloCaMP1a 138327 pAAV-synapsin-HaloCaMP1a-EGFP Syn HaloCaMP1a EGFP Constitutive 1...Schreiter Calcium Sensor: HaloCaMP1b 138328 pAAV-synapsin-HaloCaMP1b-EGFP Syn HaloCaMP1b EGFP Constitutive 1...jRGECO1 sRGECO Far-Red/NIR Calcium Sensors HaloCaMP1a HaloCaMP1b NIR-GECO Acetylcholine Sensors iAChSnFR ...Sensors 209655 pAAV.CAGFLEX.(cyto).iATPSnFR2.S29W.A95K.HaloTag CAG iATPSnFR2 none Constitutive 5 Brown , ...

  3. CRISPR Plasmids - Tagging

    Type
    Collection
    ... your gene of interest Mendenhall and Myers Tagging System The Eric Mendenhall and Richard Myers labs ...homology arm cloning: Mendenhall & Myers FETCh-seq Protocol 134.7 KB Mendenhall and Myers Tagging Plasmids... the homology arms for the donor plasmid. The Mendenhall and Myers labs have also provided their protocol...

  4. Zinc Finger Consortium: Zinc Finger Arrays

    Type
    Collection
    ... Method Full Target Site (5' to 3') Left half-site Right half-site CACNA1F OZ507 and OZ508 OPEN OPEN gCGTGACCTCgctgatAAGAAGAGg...on the length of the spacer sequence between the half-sites (see Nuclease Expression Vectors for more ...and OZ540 OPEN OPEN tTGCATCCACggcagTCGGCAGTGc Encephalopsin (Opn3) OZ541 and OZ542 OPEN OPEN aTCCATCCCAaacacatGTGGCAGAAt...

  5. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Podgorski Calcium HaloCaMP1 chemigenetic calcium indicator for fluorescence using HaloTag ligands Bright ...Schreiter Calcium WHaloCaMP1 chemigenetic calcium indicator for fluorescence using HaloTag ligands A modular...30875-83. Wolf Frommer Trehalose Single fluorescent protein biosensor for trehalose Rapid construction of...Proc Natl Acad Sci U S A. 2019 Aug 1. Alexander Gottschalk Voltage Near-infrared fluorescent voltage indicator...

  6. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...were not plated, freeze half of the cells for future plating. Plate the other half for screening and primer...using the Qiagen Miniprep Kit. Zhang S, Cahalan MD. J. Vis. Exp . 2007. PubMed . Transformation... using the heat shock method. Froger A, Hall JE. J. Vis. Exp . 2007. PubMed . Molecular cloning...

  7. Zhang Lab CRISPR Page

    Type
    Collection
    ..., Konermann S, Agarwala V, Li Y, Fine EJ, Wu X, Shalem O, Cradick TJ, Marraffini LA, Bao G, Zhang F. Nat... CRISPR-Cas9 knockout screening in human cells. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelsen...genome-wide libraries for CRISPR screening. Sanjana NE, Shalem O, Zhang F. Nat Methods . 2014 Aug;11(8):783-4....WX, Scott DA, Gootenberg JS, Kriz AJ, Zetsche B, Shalem O, Wu X, Makarova KS, Koonin EV, Sharp PA, Zhang...

  8. CRISPR Guide

    Type
    Collection
    ...less widely used in bacteria due to technical challenges, bacterial CRISPR libraries have been developed... S., Agarwala, V., Li, Y., Fine, E. J., Wu, X., Shalem, O., Cradick, T. J., Marraffini, L. A., Bao, G....., Gootenberg, J. S., Kriz, A. J., Zetsche, B., Shalem, O., Wu, X., Makarova, K. S., Koonin, E. V., Sharp...790. PMID: 38216671 Klompe, S. E., Vo, P. L. H., Halpin-Healy, T. S., & Sternberg, S. H. (2019). Transposon-encoded...Communications . 9 (11), e1007749. PMID: 30575746 Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott...cells. Science . 343 (6166), 84–87. PMID: 24336571 Shalem, O., Sanjana, N. E., & Zhang, F. (2015). High-throughput...Meadows, S. K., Roberts, B. S., Mackiewicz, M., Mendenhall, E. M., & Myers, R. M. (2015). CETCh-seq: CRISPR...

  9. Luciferase Plasmid Collection

    Type
    Collection
    ...luciferase and Renilla luciferase have short protein half-lives, making them useful as transcriptional reporters...experiments possible, but its short luminescence half-life makes it too dim for many experimental systems...wavelengths : NanoLuc® with either SNAP‐tag or HaloTag7 tag in which labeling of the self‐labeling tag...biosensor that utilizes Renilla luciferase and a Halo tag to assay mRNA decay in real time. pKC-4.04, ...

  10. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ...AiE0027m_3xC3 SYFP2 Ventromedial hypothalamic nucleus (VMH) Hypothalamus 230531 pAAV-AiE2150m-minBG-SYFP2...formation Cortical subplate Striatum Pallidum Hypothalamus Cerebellum Whole brain Addgene ID Plasmid Allen...Gore BB, Graybuck L, Greisman N, Haeseleer F, Halterman C, Helback O, Hockemeyer D, Huang C, Huff S, Hunker...

  11. Plant Plasmids and Resources

    Type
    Collection
    ...distributes diverse seed and other stocks of Arabidopsis thaliana and related species. The Arabidopsis Information...genetic and molecular biology data for Arabidopsis thaliana research. BAR The Bio-Analytic Resource for Plant...Database of gene expression profiles in Arabidopsis thaliana based on RNA-seq analysis. Return to top Do you...

  12. TALEN Plasmids and Kits

    Type
    Collection
    ...TALEN Kit 49042 EMM65 Bradley Bernstein and Eric Mendenhall The TALE plasmid vectors described on this page...4 (H3K4) di-methylation at the target locus ( Mendenhall et al., 2013 ). This epigenome editing was also...49044 EMM71T Golden Gate TALEN 2.0 49401 pBlue-TAL Michal Zurovec pBlue-TAL was designed for use with the...

  13. Rett Syndrome

    Type
    Collection
    ... results in approximately half of cells expressing wild-type MECP2 and half expressing mutant MECP2 . ...Kankirawatana et al. 2006. Early progressive encephalopathy in boys and MECP2 mutations. Neurology . 67...

  14. Deisseroth INTRSECT Collection

    Type
    Collection
    ..., Deisseroth K, Carlén M, Meletis K. 2019. A hypothalamus-habenula circuit controls aversion. Mol. Psychiatry... Osten P, Sabatini BL. 2019. Distinct Cortical-Thalamic-Striatal Circuits through the Parafascicular Nucleus...window) Marcinkiewcz CA, Mazzone CM, D'Agostino G, Halladay LR, Hardaway JA, DiBerto JF, Navarro M, Burnham...

  15. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...WX, Scott DA, Gootenberg JS, Kriz AJ, Zetsche B, Shalem O, Wu X, Makarova KS, Koonin EV, Sharp PA, Zhang...Smith SB, Meadows SK, Roberts BS, Mackiewicz M, Mendenhall EM, Myers RM. 2015. CETCh-seq: CRISPR epitope...proteins. Genome Res . 25(10):1581-9. PMID: 26355004 Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelson...

  16. Distribution to Industry

    Type
    Collection
    ...agreements allow Addgene to distribute plasmids on behalf of the depositing institutions. These agreements...signatory is someone who can execute legal documents on behalf of the recipient institution. Once the MTA has ...

  18. TALEN Guide

    Type
    Collection
    ...led by Jens Boch at the Martin-Luther-University Halle-Wittenberg and Adam Bogdanove at Iowa State University...into a single construct would be technically challenging. Thanks to efforts by the Bogdanove group and...

  19. CRISPR References and Information

    Type
    Collection
    ...pCRISPR new spacer cloning pCRISPR PDF, 109 KB Mendenhall and Myers Mammalian: FLAG tagging endogenous ...tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s) PDF, 49 KB Vosshall and Matthews (Link opens in a new window) CRISPR...

  20. Cre-lox system

    Type
    Collection
    ...respectively. Split Cre: Cre recombinase is split in half into N and C terminal Cre fragments (NCre and CCre...s View References Lakso M, Sauer B, Mulder KL, Westphal H. 1992. Targeted Oncogene Activation by Site-...
Showing: 21 - 40 of 433 results