Skip to main content
Addgene

We narrowed to 1,042 results for: STI

Showing: 21 - 40 of 1042 results
  1. Plan Your Experiment

    Type
    Guide
    ...have a biological question in mind. Then you can decide how to answer that question using genetic manipulation...efficiency. So while testing multiple gRNAs is a good idea for most CRISPR experiments, testing multiple pegRNA...your specific application. Knockout : Target constitutively expressed regions, 5’ exons, or an exon known...protocol associated with the specific plasmid in question (see CRISPR protocols from Addgene depositors ...choosing a validation method, ask yourself some questions: Does the resulting population need to be identical... insertions/deletions Very inefficient Can't distinguish specific edits PCR Knockouts Large insertions...Insertions/deletions Prime and base edits HDR Can distinguish between homozygous and heterozygous edits High...
  2. Chemogenetics Guide

    Type
    Guide
    ... Human M3 muscarinic Arrestin-2/-3 CNO* Increase Arrestin translocation Arrestin signalling Nakajima &...vivo and the receptors exhibited high levels of constitutive activity, making them less than ideal. DREADDs...insensitivity to endogenous ligands, have low constitutive activity, and their activating ligands have ...G-protein and activate neuronal firing through stimulating phospholipase C, which releases intracellular...This DREADD was shown to have a small amount of constitutive activity, and is not widely used. There is also... also a DREADD that couples to β-arrestin to activate noncanonical GPCR signaling independent of G proteins...Gleixner J, Klein ME, Lu D, Barter JW, Rossi MA, Augustine GJ, Yin HH, Hochgeschwender U (2016). Luminopsins...
  3. Promoters

    Type
    Guide
    ...Description CMV Constitutive Strong mammalian promoter from human cytomegalovirus EF1a Constituitve Strong mammalian... factor 1 alpha CAG Constitutive Strong hybrid mammalian promoter PGK Constitutive Mammalian promoter ...Description T7 Constitutive but requires T7 RNA polymerase Promoter from T7 bacteriophage Sp6 Constitutive but requires...Inducible Tetracycline response element promoter U6 Constitutive Human U6 nuclear promoter for small RNA expression... simpler than eukaryotic transcription bacteria still have complex systems of gene regulation, like operons...polymerase Promoter from Sp6 bacteriophage lac Constitutive in the absense of lac repressor (lacI or lacIq...
  4. Molecular Biology Reference

    Type
    Guide
    ...thousand basepairs from the entire human genome. Digesting the human genome with restriction enzymes would...amplified) by bacteria, which is an important characteristic of why plasmids are convenient and easy to ...survive antibiotic treatment. It is important to distinguish that the antibiotic resistance gene is under ... easy insertion of DNA by restriction enzymes digestion and ligation. In expression plasmids, the MCS ...can be used for cloning by restriction enzyme digestion. For more information about restriction enzymes...are now used for a variety of studies used to investigate promoters, small RNAs, or other genetic elements...gram-negative, rod shaped bacteria naturally found in the intestinal tract of animals. There are many different naturally...
  5. Adenovirus Guide

    Type
    Guide
    ...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid...creating first-generation rAdV vectors, which is still the most commonly used generation for research purposes...greater ability to avoid vector-neutralizing pre-existing immunity. Pseudotypes Pseudotyping is the process...developed a serotype-specific immune response. Preexisting immunity lowers viral vector uptake and transgene...vectors are also being used in cancer therapy to stimulate anti-tumor immune response in different ways, ...high titers for their use in experiments. Needle sticks and ripped gloves are common points of entry. Biosafety...office can provide more information on your institution's best practices with regard to AdV research. ...
  6. Lentiviral Vector Guide

    Type
    Guide
    ...the required components have been separated into distinct plasmids for safety. For a summary of all lentiviral...replicate on their own. While the viral components are still separated on different plasmids, the viral genome...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid...knowing the general preference for integration, it is still random and difficult to predict. In therapeutic ...particles. However, VSV-G is toxic under long-term, constitutive expression. In order to make stable cell lines...contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points of entry. Biosafety...office can provide more information on your institution's best practices with regard to lentiviral-related...
  7. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid...occur, although at a low frequency which has been estimated to range from 0.01% to 3% depending on cell type...for the treatment of other major diseases such as cystic fibrosis and cancer. Neuronal Tracing Recombinant... splice site donor and acceptor sequences to reconstitute the two pieces of the transgene. The first vector...delivery of larger transgenes, but expression is still much less efficient than with a single rAAV vector...contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points of entry. Biosafety...office can provide more information on your institution's best practices with regard to AAV-related research...
  8. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...these required components have been separated into distinct plasmids for safety to reduce the chance of creating...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid...particles. However, VSV-G is toxic under long-term, constitutive expression. In order to make stable cell lines...contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points of entry. Biosafety...office can provide more information on your institution's best practices with regard to gamma-retroviral-related...10.3390/v13081471 PMID: 34452336 Schnierle, B. S., Stitz, J., Bosch, V., Nocken, F., Merget-Millitzer, H....Some newer plasmids use a hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates...
  9. Modular Cloning Guide

    Type
    Guide
    ...chloroplast-specific genetic modules, including destination vectors specific for tobacco ( N. tabacum ) or...Expression Paul Freemont 78 plasmids including constitutive promoters, T7 expression, RBS strength variants...nonfunctional "dummy" parts, 34 backbones, and 6 destination vectors for use in E. coli for a variety of applications...Bacterial Expression Marco Trujillo Plasmids for reconstituting the ubiquitination cascades of different organisms...Takashi Yamamoto Nine pFUS array vectors and destination vectors designed for use with the Golden Gate...
  10. Sequencing Primers

    Type
    Guide
    ... sequencing primer" and "3' sequencing primer". Still not sure what primer you need? Email us at [email protected] GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP vs EYFP, reverse primer F1ori-...primer HAT GAGGAGCACGCTCATGCCCAC (BD Biosciences) Histidine affinity tag, forward primer hGH-PA-R CCAGCTTGGTTCCCAATAGA...
  11. Science Guides

    Type
    Guide
    ...engineered receptors to selectively control and investigate cell signaling pathways. Receptors are remotely...
  12. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...must contact your institution’s Bio-Safety office to receive permission and institution-specific instructions... your institution and from the CDC and NIH for work in a BL2 facility. If you have any questions about...Recommended materials C.2 Annealing oligos C.3 Digesting pLKO.1 TRC-Cloning Vector C.4 Ligating and transforming...vector has a 1.9kb stuffer that is released by digestion with AgeI and EcoRI. shRNA oligos are cloned into...selection are continuously being improved. Below are suggestions for target selection. Use an siRNA selection ...targets for your gene. For example, the Whitehead Institute for Biomedical Research hosts an siRNA Selection...Additional design rules can be found at the Broad Institute's TRC shRNA Design Process . To minimize degradation...
  13. Molecular Biology Protocol - Restriction Digest of Plasmid DNA

    Type
    Protocol
    ... are digesting a large number of plasmids with the same enzyme(s) (for instance, in a diagnostic digest... DNA Ligation Introduction Restriction enzyme digestion takes advantage of naturally occurring enzymes...opens in a new window) NEB . Restriction enzyme digestion is commonly used in molecular cloning techniques...to quickly check the identity of a plasmid by diagnostic digest . Last Upload: Oct. 11th, 2016 Protocol...Pro-Tip If you are conducting a double digest (digesting with two enzymes at the same time), you will need...DNA that you cut depends on your application. A diagnostic digest typically involves ∼500 ng of DNA, while...volume of DNA to be cut. A typical restriction digestion reaction could look like this: 1 µg DNA 1 µL of...
  14. AAV Production in HEK293 Cells

    Type
    Protocol
    ...needed. Add stir bar and stir slowly at 4 °C for 1 h, then keep at 4 °C for 3 h without stirring to allow...controller Hazardous waste container pH meter Stir plate Magnetic stir bar Sonicator Ear protection Vortex Reagents...other than PES. AAV particles stick to many other surfaces, but do not stick to PES. Using a PES filter ... FBS media causes less filter clogging during harvesting. The addition of sorbitol has been shown to increase...PEI powder into 100 mL of deionized water. While stirring, slowly add hydrochloric acid until the solution...deionized water and adjust to a final volume of 1000 mL. Stir at RT until fully dissolved. Pro-Tip This step is... challenging due to the high viscosity of PEG. Stirring under medium heat will promote faster dissolution...
  15. Transfection for Recombinant Antibodies

    Type
    Protocol
    ...deionized water in a 1 L bottle and stir on a magnetic stir plate. Stir until all particles have dissolved...platform set to 120 rpm 37 °C bead bath Vortex Stir bar Magnetic stir plate pH meter Reagents HEK293 cells Recombinant...check for the presence of particles still in solution. Continue to stir until all particles have dissolved...ensure that you are in compliance with your institution’s biosafety regulations. Last Update: February...
  16. Plasmid Cloning by PCR (with Protocols)

    Type
    Protocol
    ... of the primer assist with restriction enzyme digestion (usually 3-6bp). Restriction Site: Your chosen...and then TAAGCA to improve restriction enzyme digestion. This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA... You can generate the reverse-complement using existing software (a quick internet search will lead you... The PCR product is now ready for restriction digestion. Digest Your DNA Set up restriction digests for...have compatible overhangs or no overhangs after digestion, you will need to use a phosphatase to prevent...colonies are a result of uncut empty plasmid, you will still have colonies when you do not add ligase. If the...purification. After purifying the DNA , conduct a diagnostic restriction digest of 100-300ng of your purified...
  17. Protocol - How to Ligate Plasmid DNA

    Type
    Protocol
    ...called "sticky ends", are what allow the vector and insert to bind to each other. When the sticky ends ...depicts the ligation of two sticky ends that were generated by EcoRI digestion: Usually, scientists select...that have been generated by restriction enzyme digestion . Most restriction enzymes digest DNA asymmetrically...ligating to itself during the ligation process. If the sticky ends on either side of the vector are compatible...
  18. Biosensor AAV Preps

    Type
    Collection
    ...iAChSnFR none Constitutive 1 Looger 137955 pAAV.CAG.iAChSnFR CAG iAChSnFR none Constitutive 1, 9 Looger ... none Constitutive 1, 5, rg* Looger 176753 AAV-mDlx-jGCaMP8f-WPRE Dlx jGCaMP8f none Constitutive 1, 9,...jGCaMP8f none Constitutive 1, 9 Looger 179254 AAV-CAG-jGCaMP8f-WPRE CAG jGCaMP8f none Constitutive 1, 9, rg...ribo-jGCaMP8s none Constitutive 1 Fyhn 169256 AAV-hSyn-Soma-jGCaMP8s Syn soma-jGCaMP8s none Constitutive 1, 9, rg...none Constitutive 1, 5, 9, rg* Looger 176755 AAV-mDlx-jGCaMP8s-WPRE Dlx jGCaMP8s none Constitutive 1, 9...jGCaMP8s none Constitutive 1, 9 Looger 179256 AAV-CAG-jGCaMP8s-WPRE CAG jGCaMP8s none Constitutive 1, 9, rg...ribo-jGCaMP8m none Constitutive 1 Fyhn 169257 AAV-hSyn-Soma-jGCaMP8m Syn soma-jGCaMP8m none Constitutive 1, 9, rg...
  19. Control AAV Preps

    Type
    Collection
    ... gfaABC1D tdTomato Constitutive 5 Khakh 50465 pAAV-hSyn-EGFP hSyn EGFP Constitutive 1, 2, 5, 8, 9, 11,...hSyn tdTomato Constitutive 5 Zeng 58909 pAAV-GFAP104-mCherry GFAP104 mCherry Constitutive 5 Boyden 59462...GFA104 EGFP Constitutive 5 Haydon 104055 pAAV-CAG-eYFP CAG EYFP Constitutive 2, 5, rg*, PHP.eB Gradinaru... NLS-GFP Constitutive PHPeB Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive 1, 2, 5, ...CMV LacZ Constitutive 5, 8 Wilson 105532 pAAV.CMV.ffLuciferase.SV40 CMV ffLuciferase Constitutive 8 Wilson...pAAV.TBG.PI.LacZ.bGH TBG LacZ Constitutive 8 Wilson 105536 pAAV.TBG.PI.Null.bGH TBG none Constitutive 8 Wilson 105539...Syn EGFP Constitutive 1 Wilson 105541 pENN.AAV.CamKII0.4.eGFP.WPRE.rBG CamKII EGFP Constitutive 1, 5 Wilson...
  20. Optogenetics AAV Preps

    Type
    Collection
    ...Venus Constitutive 1, 9 Svoboda 83898 pAAV-mDlx-ChR2-mCherry-Fishell-3 Dlx ChR2 mCherry Constitutive 1, ...EYFP Constitutive 9 Deisseroth 122063 pAAV-EF1α1.1-ChrimsonR-GFP EF1a ChrimsonR GFP Constitutive 2 Boyden...t) mScarlet Constitutive 9 Harvey 59170 pAAV-Syn-Chronos-GFP Syn Chronos GFP Constitutive 1, 5, rg* Boyden... ChETA EYFP Constitutive 9 Deisseroth 135633 pAAV-S5E2-C1V1-eYFP E2 C1V1 EYFP Constitutive 1, 5, 9, PHPeB...EYFP Constitutive 1, 9 Deisseroth 26972 pAAV-hSyn-eNpHR 3.0-EYFP Syn eNpHR 3.0 EYFP Constitutive 2, 5 ...dependent Flp dependent Cre and Flp dependent Constitutive Serotype AAV1 AAV2 AAV5 AAV8 AAV9 AAVrg PHPeB...135634 pAAV-S5E2-ChR2-mCherry nEF ChR2 mCherry Constitutive 1, 9, PHPeB Dimidschstein 137142 pAAV-nEF-Con...
Showing: 21 - 40 of 1042 results