Skip to main content

We narrowed to 403 results for: aga

Showing: 21 - 40 of 403 results
  1. COVID-19 Resources

    Type
    Collection
    ...Interaction Network Antibody Neutralization Response Against Pseudoviruses Expressing SARS-CoV-2 Spike Protein...DETECTR No Llamas Required - Synthetic Nanobodies Against Membrane Proteins Return to top Pooled Libraries...
  2. CRISPR Guide

    Type
    Collection
    ...systems that bacteria and archaea use to protect against these foreign nucleic acids. Acr family members...3' NNNNGATT Streptococcus thermophilus (ST) 3' NNAGAAW Treponema denticola (TD) 3' NAAAAC Additional Cas9s..., Weinstein, J. A., Ran, F. A., Konermann, S., Agarwala, V., Li, Y., Fine, E. J., Wu, X., Shalem, O., ...: 27984730 Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott, D. A., & Zhang, F. (2013). Genome ...
  3. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...site is widely used. Flp FRT GAAGTTCCTATTCCGAAGTTCCTATTCtctagaaaGTATAGGAACTTC 13 bp inverted repeats + 8... F3, F5, FRT14, FRT15 minimal FRT GAAGTTCCTATTCtctagaaaGTATAGGAACTTC Table 1. Summary of Cre, Dre, and...
  4. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...easily identify your protein using an antibody against that epitope. This could allow you to conduct...favorite gene even if you do not have an antibody against it. Another common scenario is fusing your...
  5. CRISPR Plasmids - Parasites

    Type
    Collection
    ...knockout gRNA pooled library designed with 10 guides against 8,158 predicted protein-coding genes. To find emtpy...
  6. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ... Pseudotyping Antibody Neutralization Response Against Pseudoviruses Expressing SARS-CoV-2 Spike Protein...
  7. Antibody Production

    Type
    Collection
    ...thawing on ice, and then testing for loss of potency against a non-treated control in one of its recommended...
  8. mTOR Pathway

    Type
    Collection
    ...proline rich) PTEN Phosphatase and tensin homolog Rag RRAGA RRAGB RRAGC RRAGD Ras-related GTP binding Raptor...
  9. Promega Plasmid Collection

    Type
    Collection
    ...in two formats: pretransformed in bacteria as an agar stab 20 µg purified DNA in Tris buffer (500 ng/µL...
  10. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...promoter pLL3.7-TNFa-shRNA3 72598 Expresses shRNA against mouse TNF-alpha mRNA from the mouse U6 promoter...
  11. AAV Molecular Tools

    Type
    Collection
    ...plasma membrane-tethered ibARK in astrocytes. 5 Jun Nagai Anterograde Transsynaptic Tracers These AAV encode...
  12. Viral Production

    Type
    Collection
    ...possible, all plasmids used for viral production are propagated in the endA -mutated NEB Stable strain of E. ...
  13. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Frontotemporal dementia in GRN mutation carriers Michele Pagano 210366 TMEM106B-EGFP TMEM106B GFP CMV, T7 Frontotemporal...Frontotemporal dementia in GRN mutation carriers Michele Pagano 210899 pFBOH-MHL_LRRK2:2141-2527 LRRK2 His polH...pFastBac-GST-TBK1 TBK1 His, TEV, GST polH ALS Jonathan Kagan 221522 SYNJ1_BirA_Cterm SYNJ1 BirA, Flag CMV Parkinsonism...231998 pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc CHMP2B Cbh ALS Franz-Ulrich Hartl 232000...
  14. Luciferase Plasmid Collection

    Type
    Collection
    ...CMV Mammalian expression of Nano-lantern Takeharu Nagai 87121 pcDNA-RLuc8 Renilla CMV Mammalian expression...
  15. Plasmids for Stem Cell Research

    Type
    Collection
    ...human Sox2, KLF4, L-Myc, Lin28, OCT3/4, and shRNA against p53 in different gene/insert combinations A more...
  16. Antibodies 101: Immunoprecipitation

    Type
    Blog Post
    ...method, an antibody against a target protein is immobilized, or tethered, on agarose or magnetic beads ...antibody, often called the capture antibody, to agarose or magnetic beads in a way that also allows the... the recombinant Protein A/G are conjugated to agarose or magnetic beads and allowed to bind to the antibody... The beads can be collected by centrifugation (agarose beads) or a magnet (magnetic beads), providing ...these, antibodies can be directly conjugated to agarose or magnetic beads with commercially available chemical... beads, there are several factors to consider. Agarose beads are sponge-like and vary in shape and structure...solid spheres and tend to be much smaller than agarose beads. Proteins conjugate on the surface of magnetic...
Showing: 21 - 40 of 403 results