Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 643 results for: ato

Showing: 21 - 40 of 643 results

  1. Brain Armamentarium

    Type
    Collection
    ...Gradinaru 213944-PHPeB pAAV_BiSSTe4_dTomato_nlsdTomato AAV construct expressing dTomato driven by SST interneuron-targeting...Gradinaru 213940-PHPeB pAAV_BiPVe3_dTomato_nlsdTomato AAV construct expressing dTomato driven by PV+ basket...Gradinaru 213936-PHPeB pAAV_BiPVe4_dTomato_nlsdTomato AAV construct expressing dTomato driven by chandelier...213914-PHPeB pAAV_BiLAMP5e3_dTomato_nlsdTomato_nlsdTomato AAV construct expressing dTomato driven by Lamp5...Gradinaru 213855-PHPeB pAAV_BiVIPe4_dTomato_nlsdTomato AAV construct expressing dTomato driven by VIP interneuron-targeting...Gradinaru 213829-PHPeB pAAV_BiCHATe27_dTomato_nlsdTomato AAV construct expressing dTomato driven by cholinergic...Gradinaru 213814-PHPeB pAAV_BiSSTe10_dTomato_nlsdTomato AAV construct expressing dTomato driven by SST interneuron-targeting...

  2. Immunology Research Plasmids and Resources

    Type
    Collection
    ...MGC110940, OPN SST somatostatin SMST SSTR1 somatostatin receptor 1 SRIF-2 SSTR2 somatostatin receptor 2 - SSTR5... IREL RFX5 regulatory factor X, 5 (influences HLA class II expression) - RFXANK regulatory factor X-associated...kinase, regulatory subunit 1 (alpha) GRB1, p85, p85-ALPHA PIK3R2 phosphoinositide-3-kinase, regulatory subunit...PLAU plasminogen activator, urokinase ATF, UPA, URK, u-PA PLAUR plasminogen activator, urokinase receptor...CSH2 chorionic somatomammotropin hormone 2 CS-2, CSB, hCS-B CSHL1 chorionic somatomammotropin hormone-like...HMG1L2 HDGFRP3 hepatoma-derived growth factor, related protein 3 CGI-142, HDGF2 HGF hepatocyte growth factor...MSTN myostatin GDF8 MTNR1A melatonin receptor 1A MEL-1A-R, MT1 MTNR1B melatonin receptor 1B MEL-1B-R, MT2...

  3. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...pAdx-CMV-iCre-P2A-tdTomato 73351 Expresses iCre and tdTomato from the CMV promoter pAdxEF1-FLPe-tdTomato 73352 Expresses...expressed by another vector pCDH-EF1-DIO-tdTomato 72254 Expresses tdTomato under EF-1 promoter when Cre is expressed...pCDH-CB-iCre-P2A-tdTomato-T2A-Puro 72255 NOT AVAILABLE YET Cre is coexpressed with tdTomato and Pac (puromycin... CB promoter pCDH-CB-FLPe-P2A-tdTomato 72259 Expresses FLPe and tdTomato from the CB promoter pCDH-EF1...expressed by another vector pCDH-EF1-Fon-tdTomato 72261 Expresses tdTomato from the EF1 promoter when FLP is ...EF1 promoter pCDH-EF1-Luc2-P2A-tdTomato 72486 Expresses Luc2 and tdTomato from the EF1 promoter pLL3.7-...copGFP from the CMV promoter pAdx-CMV-tdTomato 73347 Expresses tdTomato from the CMV promoter pAdx-CMV-YFP...

  4. Control AAV Preps

    Type
    Collection
    ...AAV9-X1.1 Boyden 44332 pZac2.1 gfaABC1D-tdTomato gfaABC1D tdTomato Constitutive 5 Khakh 50465 pAAV-hSyn-...rg*, PHP.eB Roth 51506 AAV phSyn1(S)-tdTomato-WPRE hSyn tdTomato Constitutive 5 Zeng 58909 pAAV-GFAP104...mCherry Constitutive 5 Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB,...Deisseroth 135630 pAAV-S5E2-dTom-nlsdTom E2 regulatory dTomato Constitutive 1, 9, PHP.eB Dimidschstein 135631...Deisseroth 192552 pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA CAG tdTomato Constitutive 9, PHP.eB Feng 27056...2, 5, 9, rg* Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato Cre dependent 1, 2, 5, 8, 9, rg*, PHP.eB...9, rg* Fishell 83894 pAAV-hDlx-Flex-dTomato-Fishell_7 Dlx dTomato Cre dependent 1, 2, 5, 9, rg* Fishell...

  5. Validated gRNA Sequences

    Type
    Collection
    ...25619936 Sato ASCL1 H. sapiens TGGGCAGCCGCTCGCTGCAGCAG 64130 activate S. pyogenes 25619936 Sato ASCL1 H...25619936 Sato ASCL1 H. sapiens TGGTGTTTATTCAGCCGGGAGTC 64132 activate S. pyogenes 25619936 Sato Asip R....pyogenes 25619936 Sato GAL4UAS TGGGTCTTCGGAGGACAGTACTC 64157 activate S. pyogenes 25619936 Sato GAL4UAS TGGTCCGTCTAGAAACTCGGTAC...25619936 Sato IL1RN H. sapiens TGGCATCAAGTCAGCCATCAGC 64151 activate S. pyogenes 25619936 Sato IL1RN H....25619936 Sato IL1RN H. sapiens TGGTGTACTCTCTGAGGTGCTC 64140 activate S. pyogenes 25619936 Sato inverted...25619936 Sato MYOD1 H. sapiens TGGGAGGTTTGGAAAGGGCGTGC 64139 activate S. pyogenes 25619936 Sato MYOD1 H...25619936 Sato MYOD1 H. sapiens TGGGGGCCCCTGCGGCCACCCCG 64137 activate S. pyogenes 25619936 Sato NANOG H...

  6. Cre-lox system

    Type
    Collection
    ...expressed in excitatory neurons aCamKII AAV Yang 107738 pAAV-hSyn-Cre-P2A-dTomato Cre and dTomato hSyn AAV...hsp70 Xenopus Ryffel 30525 pBSHSP:Cre;CMV:tdTomato-SceI Cre and tdTomato coexpression Xenopus hsp70 Xenopus...AAV Simpson 72255 pCDH-CB-iCre-P2A-tdTomato-T2A-Puro iCre and tdtomato CB Mammalian Oka 72256 pCDH-CB-copGFP-T2A-iCre...Adenoviral Oka 73351 pAdx-CMV-iCre-P2A-tdTomato iCre and tdTomato CMV Adenoviral Oka 73472 RabV CVS-N2c...Mammalian Sato 122961 pcDNA3.1_PA-Cre-Y324F Catalytically inactive PA-Cre CMV Mammalian Sato 123128 pET-His-Cre...Bacterial Dunlop 135217 pDEST mfap4:icre-p2a-tomato iCre and tdTomato mfap4 Zebrafish Tobin 135618 pAAV-Sox2...Insect Rubin 51503 AAV pCAG-FLEX-tdTomato-WPRE Cre dependent TdTomato expression AAV Zeng 60877 pMAZe ...

  7. Optogenetics AAV Preps

    Type
    Collection
    ...Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG ChR2/H134R tdTomato Constitutive rg* Svoboda 75470 pAAV-CAG-FLEXFRT-ChR2...Syn ChrimsonR tdTomato Constitutive 1, 5, 9 Boyden 62723 pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] Syn ChrimsonR...ChrimsonR tdTomato Cre dependent 1, 5 Boyden 130909 AAV-CAG-FLPX-rc [ChrimsonR-tdTomato] CAG ChrimsonR tdTomato...Deisseroth 171027 pAAV-Ef1a-fDIO-ChrimsonR-tdTomato EF1a ChrimsonR tdTomato Flp dependent 1, 9 Jensen 174007 pAAV-hSyn-DIO-jGCaMP8s-P2A-ChrimsonR-ST...dependent 1, 9 Boyden 28305 pAAV-FLEX-ArchT-tdTomato CAG ArchT tdTomato Cre dependent 5 Boyden 99039 pAAV-CamKII-ArchT-GFP...Boyden 84446 pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] CAG Jaws tdTomato Cre dependent 1, 5, 8 Boyden 105669...plasmids available in Addgene's collection. Opsin Excitatory Wild-type ChR2 ChR2/H134R soCoChR ChR2/other ...

  8. AAV Molecular Tools

    Type
    Collection
    ...from Addgene's viral service encoding tet-off transactivators and tools for affinity purification (TRAP)....Packaging Service: Molecular Tools Tetracycline Transactivators Affinity Purification Neurophysiology Cell ...Cell Ablation Tetracycline Transactivators and Inducible Tools These AAV encode tetracycline-inducible tools...tools/controls and tetracycline transactivators that can be used with tetracycline (tet)-inducible expression...CAG-driven, constitutive Expression of the tet-off transactivator (tTA) 2 Gradinaru 99120 pAAV-ihSyn1-tTA Inducible... promoter (ihSyn) Expression of the tet-off transactivator (tTA) with a positive feedback loop for amplified...ihSyn) Cre-dependent expression of the tet-off transactivator (tTA) with a positive feedback loop for amplified...

  9. Ras Pathway

    Type
    Collection
    ... Frederick National Laboratory for Cancer Research . Frederick National Laboratory for Cancer Research...RASA3 RAS p21 protein activator RASAL RASAL1 RASAL2 RASAL3 RAS protein activator like RASGRF RASGRF1 RASGRF2...Catalytic Subunits PIK3CA PIK3CB PIK3CD PIK3CG Regulatory Subunits PIK3R1 PIK3R2 PIK3R3 PIK3R4 PIK3R5 PIK3R6...Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic and regulatory subunits - Class I PIN1 Peptidylprolyl cis/trans... 1 RALGDS Ral guanine nucleotide dissociation stimulator RAPGEF RAPGEF1 RAPGEF2 Rap guanine nucleotide... RPS6KB2 Ribosomal protein S6 kinase B1 RPTOR Regulatory associated protein of MTOR, complex 1 SAV1 Salvador...

  10. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ... AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng AV-9-ALL864 51503-AAV9 AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng...100048-AAV1 pAAV.CAG.LSL.tdTomato Hongkui Zeng AV-9-ALL856 100048-AAV9 pAAV.CAG.LSL.tdTomato Hongkui Zeng...Wilson AV-5-PV3106 44332-AAV5 pZac2.1 gfaABC1D-tdTomato Control Baljit Khakh AV-8-PV0101 105530-AAV8 pAAV.CMV.PI.EGFP.WPRE.bGH...Wilson AV-1-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Optogenetics Scott Sternson AV-1-20071P 20071-...Deisseroth AV-5-PV2510 28305-AAV5 pAAV-FLEX-ArchT-tdTomato Optogenetics Ed Boyden AV-5-PV2527 99039-AAV5 ... Kim AV-10-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-10-PV1963 105542-AAV1 pENN.AAV.CB7...Wilson AV-5-18917P 18917-AAV5 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-5-20071P 20071-AAV5 pACAGW-ChR2...

  11. Chemogenetics AAV Preps

    Type
    Collection
    ...nEF CAG E2 regulatory element Tag Fusion tags mCherry HA Non-fusion tags mCitrine EGFP dTomato Activity ...83896 pAAV-hDlx-GiDREADD-dTomato-Fishell-5 hM4D(Gi) - Inhibition NLS-dTomato none 1, 9, rg* Fishell 83897...83897 pAAV-hDlx-GqDREADD-dTomato-Fishell-4 hM3D(Gq) - Activation NLS-dTomato none 1, 9, rg* Fishell 50472...Deisseroth 135635 pAAV-S5E2-Gq-P2A-dTomato hM3D(Gq) - Activation dTomato (physically separate) none 1, 9,...

  12. CRISPR Guide

    Type
    Collection
    ...effective gene activators when fused with dCas9. Recently, synthetic CRISPR-Cas gene activators have been ...zinc finger nucleases (ZFNs) or transcription-activator-like effector nucleases (TALENs) required scientists...fusing dCas9 to transcriptional repressors or activators and targeting promoter regions. You might sometimes...mice and human cells. The simplest dCas9-based activators and repressors consist of dCas9 fused directly...directly to a single transcriptional activator (e.g. VP64) or repressor (e.g. KRAB; Figure 9A). Other examples...co-expression of epitope-tagged dCas9 and antibody-activator effector proteins; long-term imaging of proteins...instead of a two-component system (Figure 9C) SAM activators - co-expression of dCas9-VP64 with a modified...

  13. Luciferase Plasmid Collection

    Type
    Collection
    ...mutations of these regulatory elements on gene expression. Empty backbones for inserting regulatory elements before...are commonly used to investigate the effect of regulatory elements, such as promoters, enhancers and untranslated...Optimized STARR-seq ( S elf- T ranscribing A ctive R egulatory R egion) plasmids : Genome-wide screening of enhancer...cloning to test for the presence of transcriptional regulatory region in specific cell types. Used to identify...backbone plasmids into which you can clone your regulatory element or gene of interest into to create a ...Lentiviral expression of firefly luciferase and dTomato. A gene of interest can also be inserted into the...Reporter Constructs Already know what gene or regulatory element that you need a luciferase reporter for...

  14. Plasmids for Stem Cell Research

    Type
    Collection
    ...Fibroblasts Hepatocytes Retroviral Mouse Direct conversion of mouse fibroblasts to hepatocyte-like cells.... 2016 Mar 7;7:10869. Hu CRISPRa Human CRISPR activator system for reprogramming human cells to pluripotency...genes Human pluripotent reprogramming with CRISPR activators. Nat Commun. 2018 Jul 6;9(1):2643. Otonkoski ...generation OCT4 and SOX2 Work as Transcriptional Activators in Reprogramming Human Fibroblasts. Cell Rep....2013 Apr 13;60C:97-106. Gearhart Fibroblasts Hematopoietic Progenitor Cells Lentiviral Mouse Direct reprogramming...reprogramming of murine fibroblasts to hematopoietic progenitor cells. Cell Rep. 2014 Dec 11;9(5):1871-...1871-84. Lacaud Fibroblasts Hematopoietic Progenitor Cells Lentiviral Human Cooperative Transcription Factor...

  15. Biosensor AAV Preps

    Type
    Collection
    ...-nls-dTomato EF1a GCaMP6f dTomato Cre dependent rg* Ting 51085 AAV-hSyn1-GCaMP6f-P2A-nls-dTomato Syn GCaMP6f...Rose 51082 AAV-EF1a-DIO-GCaMP6s-P2A-nls-dTomato EF1a GCaMP6s dTomato Cre dependent 1 Ting 105714 pAAV-Ef1a-fDIO-GCaMP6s...Larsen 51084 AAV-hSyn1-GCaMP6s-P2A-nls-dTomato Syn GCaMP6s dTomato Constitutive 1, rg* Ting 68717 pAAV-CAG-Flex-mRuby2...CAG CaMKIIa Dlx EF1a GFAP/GfaABC1D Synapsin E2 regulatory element Activity Cre-dependent Flp-dependent ... GCaMP6f dTomato Constitutive 1, rg* Ting 52924 pZac2.1 gfaABC1D-lck-GCaMP6f GfaABC1D GCaMP6f none Constitutive...

  16. Working with Nuclear Receptors

    Type
    Blog Post
    ... for a curated list of coregulators). Coregulators can function as coactivators and corepressors depending...complexes with secondary coregulator (or co-coregulator) partners. The coregulator ‘core’ complex is composed...feature afforded by coactivator complexes suggests that coactivators may be integrators of multiple cell ...illnesses, and the metabolic syndrome. Coregulators Coregulators constitute a group of some 400 molecules...that coregulators belong to distinct complexes may explain how more than 300 different coactivator proteins...manner. Because coregulators exist as multiprotein complexes, a member of a single coactivator complex can... W. (2002). Combinatorial control of gene expression by nuclear receptors and coregulators. Cell 108, ...

  17. Rett Syndrome

    Type
    Collection
    ...NLucTom Knock-in of NLuc-tdTomato at endogenous MECP2 locus Castaneus MECP2-NLuc-tdTomato mouse reporter cell... working with the RSRT along with individual laboratories to assemble a Rett Syndrome plasmid resource...The MECP2 protein is a global transcriptional regulator of thousands of genes and studies have suggested...contains a Nuclear receptor Co-Repressor 1/Silencing Mediator of Retinoic acid and Thyroid hormone receptor ...contact information by following the link to their laboratory website. Mouse Line Mutation (DNA) Background...contact information by following the link to their laboratory website. Cell Line Mutation (DNA) Mutation (protein...prenatal LMD microarray data, ISH image data, and anatomic reference atlases of prenatal and adult human ...

  18. CRISPR References and Information

    Type
    Collection
    ...Goldstein Nematode: gRNA design and cloning Cas9-sgRNA construct PDF, 364 KB Goldstein Nematode: Injection... dCas9 activators sgRNA dual expression: pAC2 , pAC152 , pAC153 , pAC154 ; pmax dCas9 activator expression... Lab and maintained by the Frederick National Laboratory at the National Cancer Institute. Cas-OFFinder...pAC91 , pAC92 , pAC93 , pAC94 , pAC95 ; dCas9 activator gateway donors: pAC84 , pAC1 , pAC147 , pAC148...; Gateway destination: pAC90 PDF, 1.1 MB Katic Nematode: Cas9 and gRNA use Cas9 (pIK86) ; gRNA empty backbone...

  19. How-to: 5 Steps to a Great Panel Discussion

    Type
    Blog Post
    ...Choose a moderator with a backbone. It is nice to have a subject area expert, but the moderator is not ...LinkedIn profiles of all panelists to the moderator. The moderator and organizers should develop a list of...(lapel mics are best). The moderator takes control It is the moderator's job to prevent anyone from ...effortless to the audience, but the organizers and moderator should have a well-planned approach to making ... of 4-6 pre-event interview questions. The moderator (possibly with an organizer) should set up a 30 minute...to schedule. In the pre-event interviews, the moderator should be taking good notes and discovering interesting...opinions that each panelist can contribute. The moderator should identify the funny, provocative or interesting...

  20. mTOR Pathway

    Type
    Collection
    .... enhanced signaling of mTOR, a key metabolic regulator, correlates with poor prognosis in many cancers...arget o f r apamycin (mTOR) is a key metabolic regulator controlling cell growth and proliferation... caused by inactivating mutations in negative regulators of mTORC1. The hyperactivation of mTORC1 in cancer...Ras-related GTP binding Raptor Also known as RPTOR; Regulatory associated protein of MTOR, complex 1 Rheb Ras...Catalytic Subunits PIK3CA PIK3CB PIK3CD PIK3CG Regulatory Subunits PIK3R1 PIK3R2 PIK3R3 PIK3R4 PIK3R5 PIK3R6...Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic and regulatory subunits - Class I PKC PKC alpha PKC beta PKC...
Showing: 21 - 40 of 643 results