We narrowed to 84 results for: ato
-
TypeCollection...MORF Feng Zhang - Multiplexed Overexpression of Regulatory Factors (MORF) Collection You may also like.....
-
Caltech Systemic Capsids
TypeCollection...BiLAMP5e3 dTomato/nlsdTomato Control Fishell 213936 pAAV_BiPVe4_dTomato_nlsdTomato BiPVe4 dTomato/nlsdTomato...pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Control...dTom-nlsdTom E2 regulatory element dTomato Control Dimidschstein 135631 pAAV-S5E2-GFP-fGFP E2 regulatory element...Control AIBS , Ting 213814 pAAV_BiSSTe10_dTomato_nlsdTomato BiSSTe10 dTomato/nlsdTomato Control Fishell 213829...213829 pAAV_BiCHATe27_dTomato_nlsdTomato BiCHATe27 dTomato/nlsdTomato Control Fishell 213855 pAAV_BiVIPe4...BiVIPe4 dTomato/nlsdTomato Control Fishell 213914 pAAV_BiLAMP5e3_dTomato_nlsdTomato_nlsdTomato BiLAMP5e3...Control Fishell 213940 pAAV_BiPVe3_dTomato_nlsdTomato BiPVe3 dTomato/nlsdTomato Control Fishell 213944... -
Fluorescent Protein Guide: Biosensors
TypeCollection...Calcium Indicators (Constitutive or Cre-dependent) jGCaMP8 Fast Genetically Encoded Calcium Indicators. Janelia...calcium indicators for optical imaging (GECOs), including blue, green, red, and ratiometric indicators An ...calcium indicator for fluorescence using HaloTag ligands A modular chemigenetic calcium indicator enables...fluorescence indicator of K+ for optical imaging (GINKO) Genetically encoded fluorescent indicators for imaging...Multicolor palette of ATP indicators (MaLion) RGB-color intensiometric indicators visualize spatiotemporal...fluorescent cAMP indicator (Flamindo2) Genetically-encoded yellow fluorescent cAMP indicator with an expanded...protein-based cAMP indicator (Pink Flamindo) Red fluorescent protein-based cAMP indicator applicable to optogenetics... -
Brain Initiative Collection
TypeCollection...83894-AAV1 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83894-AAV2 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83894-AAV5 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83894-AAV9 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83894-AAVrg pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83896-AAV1 pAAV-hDlx-GiDREADD-dTomato-Fishell-5 Gi-DREADD (P2A) nuclear dTomato expression in forebrain GABA-ergic...83896-AAV9 pAAV-hDlx-GiDREADD-dTomato-Fishell-5 Gi-DREADD (P2A) nuclear dTomato expression in forebrain GABA-ergic... -
Retrograde AAV viral preps
TypeCollection...-EYFP Syn Activator Optogenetics Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG Activator Optogenetics...Norepinephrine Dopamine Optogenetics Activators Inhibitors Bidirectional DREADDs Activators Inhibitors Other Molecular...Cre-dependent Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 50457 pAAV-hSyn-DIO-EGFP ...Flp-dependent Control Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 27056 pAAV-Ef1a-DIO...Control Fishell 83894 pAAV-hDlx-Flex-dTomato-Fishell_7 Dlx dTomato Control Fishell 104055 pAAV-CAG-eYFP...107738 pAAV-hSyn-Cre-P2A-dTomato Syn Cre expression with simultaneous dTomato expression Recombinases ...AAV-hSyn1-GCaMP6f-P2A-nls-dTomato Syn GCaMP6f and physically separate nuclear dTomato Calcium sensor Ting 51083... -
Tetracycline Inducible Expression
TypeCollection...generations of transactivators and promoters are generally cross-compatible. Your choice of transactivator, promoter...Vogelstein Transactivators (tTA or rtTA) Find a construct that expresses the transactivator for your tetracycline... the tetracycline repressor protein (TetR) and operator ( tet O, a 19 nucleotide sequence, TCCCTATCAGTGATAGAGA...response element; tTA: tetracycline-controlled transactivator (fusion of TetR with VP16 transcriptional activation...domain); rtTA: reverse tetracycline-controlled transactivator (fusion of mutated TetR with VP16 transcriptional...the Tet-Off system. A tetracycline-controlled transactivator (tTA) was created by fusing TetR with the activation...tetracycline. A new reverse tetracycline-controlled transactivator (rtTA) was created by fusing rTetR with VP16... -
Brain Armamentarium
TypeCollection...Gradinaru 213944-PHPeB pAAV_BiSSTe4_dTomato_nlsdTomato AAV construct expressing dTomato driven by SST interneuron-targeting...Gradinaru 213940-PHPeB pAAV_BiPVe3_dTomato_nlsdTomato AAV construct expressing dTomato driven by PV+ basket...Gradinaru 213936-PHPeB pAAV_BiPVe4_dTomato_nlsdTomato AAV construct expressing dTomato driven by chandelier...213914-PHPeB pAAV_BiLAMP5e3_dTomato_nlsdTomato_nlsdTomato AAV construct expressing dTomato driven by Lamp5...Gradinaru 213855-PHPeB pAAV_BiVIPe4_dTomato_nlsdTomato AAV construct expressing dTomato driven by VIP interneuron-targeting...Gradinaru 213829-PHPeB pAAV_BiCHATe27_dTomato_nlsdTomato AAV construct expressing dTomato driven by cholinergic...Gradinaru 213814-PHPeB pAAV_BiSSTe10_dTomato_nlsdTomato AAV construct expressing dTomato driven by SST interneuron-targeting... -
Immunology Research Plasmids and Resources
TypeCollection...MGC110940, OPN SST somatostatin SMST SSTR1 somatostatin receptor 1 SRIF-2 SSTR2 somatostatin receptor 2 - SSTR5... IREL RFX5 regulatory factor X, 5 (influences HLA class II expression) - RFXANK regulatory factor X-associated...kinase, regulatory subunit 1 (alpha) GRB1, p85, p85-ALPHA PIK3R2 phosphoinositide-3-kinase, regulatory subunit...PLAU plasminogen activator, urokinase ATF, UPA, URK, u-PA PLAUR plasminogen activator, urokinase receptor...CSH2 chorionic somatomammotropin hormone 2 CS-2, CSB, hCS-B CSHL1 chorionic somatomammotropin hormone-like...HMG1L2 HDGFRP3 hepatoma-derived growth factor, related protein 3 CGI-142, HDGF2 HGF hepatocyte growth factor...MSTN myostatin GDF8 MTNR1A melatonin receptor 1A MEL-1A-R, MT1 MTNR1B melatonin receptor 1B MEL-1B-R, MT2... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...pAdx-CMV-iCre-P2A-tdTomato 73351 Expresses iCre and tdTomato from the CMV promoter pAdxEF1-FLPe-tdTomato 73352 Expresses...expressed by another vector pCDH-EF1-DIO-tdTomato 72254 Expresses tdTomato under EF-1 promoter when Cre is expressed...vector pCDH-CB-iCre-P2A-tdTomato-T2A-Puro 72255 Cre is coexpressed with tdTomato and Pac (puromycin N-acethyl-transferase... CB promoter pCDH-CB-FLPe-P2A-tdTomato 72259 Expresses FLPe and tdTomato from the CB promoter pCDH-EF1...expressed by another vector pCDH-EF1-Fon-tdTomato 72261 Expresses tdTomato from the EF1 promoter when FLP is ...EF1 promoter pCDH-EF1-Luc2-P2A-tdTomato 72486 Expresses Luc2 and tdTomato from the EF1 promoter pLL3.7-...copGFP from the CMV promoter pAdx-CMV-tdTomato 73347 Expresses tdTomato from the CMV promoter pAdx-CMV-YFP... -
Validated gRNA Sequences
TypeCollection...25619936 Sato ASCL1 H. sapiens TGGGCAGCCGCTCGCTGCAGCAG 64130 activate S. pyogenes 25619936 Sato ASCL1 H...25619936 Sato ASCL1 H. sapiens TGGTGTTTATTCAGCCGGGAGTC 64132 activate S. pyogenes 25619936 Sato Asip R....pyogenes 25619936 Sato GAL4UAS TGGGTCTTCGGAGGACAGTACTC 64157 activate S. pyogenes 25619936 Sato GAL4UAS TGGTCCGTCTAGAAACTCGGTAC...25619936 Sato IL1RN H. sapiens TGGCATCAAGTCAGCCATCAGC 64151 activate S. pyogenes 25619936 Sato IL1RN H....25619936 Sato IL1RN H. sapiens TGGTGTACTCTCTGAGGTGCTC 64140 activate S. pyogenes 25619936 Sato inverted...25619936 Sato MYOD1 H. sapiens TGGGAGGTTTGGAAAGGGCGTGC 64139 activate S. pyogenes 25619936 Sato MYOD1 H...25619936 Sato MYOD1 H. sapiens TGGGGGCCCCTGCGGCCACCCCG 64137 activate S. pyogenes 25619936 Sato NANOG H... -
Control AAV Preps
TypeCollection...AAV9-X1.1 Boyden 44332 pZac2.1 gfaABC1D-tdTomato gfaABC1D tdTomato Constitutive 5 Khakh 50465 pAAV-hSyn-...rg*, PHP.eB Roth 51506 AAV phSyn1(S)-tdTomato-WPRE hSyn tdTomato Constitutive 5 Zeng 58909 pAAV-GFAP104...mCherry Constitutive 5 Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB,...Deisseroth 135630 pAAV-S5E2-dTom-nlsdTom E2 regulatory dTomato Constitutive 1, 9, PHP.eB Dimidschstein 135631...dependent 2 Kole 192552 pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA CAG tdTomato Constitutive 9, PHP.eB Feng 197200...2, 5, 9, rg* Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato Cre dependent 1, 2, 5, 8, 9, rg*, PHP.eB...9, rg* Fishell 83894 pAAV-hDlx-Flex-dTomato-Fishell_7 Dlx dTomato Cre dependent 1, 2, 5, 9, rg* Fishell... -
Optogenetics AAV Preps
TypeCollection...ChrimsonR tdTomato Cre dependent 1, 5 Boyden 62726 pAAV-Syn-Chronos-tdTomato Syn Chronos tdTomato Constitutive...Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG ChR2/H134R tdTomato Constitutive rg* Svoboda 75470 pAAV-CAG-FLEXFRT-ChR2...Syn ChrimsonR tdTomato Constitutive 1, 5, 9 Boyden 62723 pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] Syn ChrimsonR... 130909 AAV-CAG-FLPX-rc [ChrimsonR-tdTomato] CAG ChrimsonR tdTomato Flp dependent 8 Boyden 100049 pAAV.hSynap.ChETA...Deisseroth 171027 pAAV-Ef1a-fDIO-ChrimsonR-tdTomato EF1a ChrimsonR tdTomato Flp dependent 1, 9 Jensen 174007 pAAV-hSyn-DIO-jGCaMP8s-P2A-ChrimsonR-ST...dependent 1, 9 Boyden 28305 pAAV-FLEX-ArchT-tdTomato CAG ArchT tdTomato Cre dependent 5 Boyden 99039 pAAV-CamKII-ArchT-GFP...Boyden 84446 pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] CAG Jaws tdTomato Cre dependent 1, 5, 8 Boyden 105669... -
AAV Molecular Tools
TypeCollection...paavCAG-post-mGRASP-2A-dTomato CAG-driven, constitutive Expression of post-synaptic mGRASP-dTomato for synaptic ...from Addgene's viral service encoding tet-off transactivators and tools for affinity purification (TRAP)....Packaging Service: Molecular Tools Tetracycline Transactivators Affinity Purification Neurophysiology Cell ...Engineering Labeling Overexpression Tetracycline Transactivators and Inducible Tools These AAV encode tetracycline-inducible...-inducible tools/controls and tetracycline transactivators that can be used with tetracycline (tet)-inducible...CAG-driven, constitutive Expression of the tet-off transactivator (tTA) 2 Viviana Gradinaru 99120 pAAV-ihSyn1... promoter (ihSyn) Expression of the tet-off transactivator (tTA) with a positive feedback loop for amplified... -
Ras Pathway
TypeCollection... Frederick National Laboratory for Cancer Research . Frederick National Laboratory for Cancer Research...RASA3 RAS p21 protein activator RASAL RASAL1 RASAL2 RASAL3 RAS protein activator like RASGRF RASGRF1 RASGRF2...Catalytic Subunits PIK3CA PIK3CB PIK3CD PIK3CG Regulatory Subunits PIK3R1 PIK3R2 PIK3R3 PIK3R4 PIK3R5 PIK3R6...Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic and regulatory subunits - Class I PIN1 Peptidylprolyl cis/trans... 1 RALGDS Ral guanine nucleotide dissociation stimulator RAPGEF RAPGEF1 RAPGEF2 Rap guanine nucleotide... RPS6KB2 Ribosomal protein S6 kinase B1 RPTOR Regulatory associated protein of MTOR, complex 1 SAV1 Salvador... -
Penn Vector Core Partnership with Addgene
TypeCollection... AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng AV-9-ALL864 51503-AAV9 AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng...100048-AAV1 pAAV.CAG.LSL.tdTomato Hongkui Zeng AV-9-ALL856 100048-AAV9 pAAV.CAG.LSL.tdTomato Hongkui Zeng...Wilson AV-5-PV3106 44332-AAV5 pZac2.1 gfaABC1D-tdTomato Control Baljit Khakh AV-8-PV0101 105530-AAV8 pAAV.CMV.PI.EGFP.WPRE.bGH...Wilson AV-1-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Optogenetics Scott Sternson AV-1-20071P 20071-...Deisseroth AV-5-PV2510 28305-AAV5 pAAV-FLEX-ArchT-tdTomato Optogenetics Ed Boyden AV-5-PV2527 99039-AAV5 ... Kim AV-10-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-10-PV1963 105542-AAV1 pENN.AAV.CB7...Wilson AV-5-18917P 18917-AAV5 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-5-20071P 20071-AAV5 pACAGW-ChR2... -
Chemogenetics AAV Preps
TypeCollection...nEF CAG E2 regulatory element Tag Fusion tags mCherry HA Non-fusion tags mCitrine EGFP dTomato Activity ...83896 pAAV-hDlx-GiDREADD-dTomato-Fishell-5 hM4D(Gi) - Inhibition NLS-dTomato none 1, 9, rg* Fishell 83897...83897 pAAV-hDlx-GqDREADD-dTomato-Fishell-4 hM3D(Gq) - Activation NLS-dTomato none 1, 9, rg* Fishell 50472...Deisseroth 135635 pAAV-S5E2-Gq-P2A-dTomato hM3D(Gq) - Activation dTomato (physically separate) none 1, 9,... -
CRISPR Guide
TypeCollection...effective gene activators when fused with dCas9. Recently, synthetic CRISPR-Cas gene activators have been ...zinc finger nucleases (ZFNs) or transcription-activator-like effector nucleases (TALENs) required scientists...fusing dCas9 to transcriptional repressors or activators and targeting promoter regions. You might sometimes...mice and human cells. The simplest dCas9-based activators and repressors consist of dCas9 fused directly...directly to a single transcriptional activator (e.g. VP64) or repressor (e.g. KRAB; Figure 9A). Other examples...co-expression of epitope-tagged dCas9 and antibody-activator effector proteins; long-term imaging of proteins...instead of a two-component system (Figure 9C) SAM activators - co-expression of dCas9-VP64 with a modified... -
Plasmids for Stem Cell Research
TypeCollection...Fibroblasts Hepatocytes Retroviral Mouse Direct conversion of mouse fibroblasts to hepatocyte-like cells.... 2016 Mar 7;7:10869. Hu CRISPRa Human CRISPR activator system for reprogramming human cells to pluripotency...genes Human pluripotent reprogramming with CRISPR activators. Nat Commun. 2018 Jul 6;9(1):2643. Otonkoski ...generation OCT4 and SOX2 Work as Transcriptional Activators in Reprogramming Human Fibroblasts. Cell Rep....2013 Apr 13;60C:97-106. Gearhart Fibroblasts Hematopoietic Progenitor Cells Lentiviral Mouse Direct reprogramming...reprogramming of murine fibroblasts to hematopoietic progenitor cells. Cell Rep. 2014 Dec 11;9(5):1871-...1871-84. Lacaud Fibroblasts Hematopoietic Progenitor Cells Lentiviral Human Cooperative Transcription Factor... -
Rett Syndrome
TypeCollection...NLucTom Knock-in of NLuc-tdTomato at endogenous MECP2 locus Castaneus MECP2-NLuc-tdTomato mouse reporter cell... working with the RSRT along with individual laboratories to assemble a Rett Syndrome plasmid resource...The MECP2 protein is a global transcriptional regulator of thousands of genes and studies have suggested...contains a Nuclear receptor Co-Repressor 1/Silencing Mediator of Retinoic acid and Thyroid hormone receptor ...contact information by following the link to their laboratory website. Mouse Line Mutation (DNA) Background...contact information by following the link to their laboratory website. Cell Line Mutation (DNA) Mutation (protein...prenatal LMD microarray data, ISH image data, and anatomic reference atlases of prenatal and adult human ... -
Biosensor AAV Preps
TypeCollection...-nls-dTomato EF1a GCaMP6f dTomato Cre dependent rg* Ting 51085 AAV-hSyn1-GCaMP6f-P2A-nls-dTomato Syn GCaMP6f...Rose 51082 AAV-EF1a-DIO-GCaMP6s-P2A-nls-dTomato EF1a GCaMP6s dTomato Cre dependent 1 Ting 105714 pAAV-Ef1a-fDIO-GCaMP6s...Larsen 51084 AAV-hSyn1-GCaMP6s-P2A-nls-dTomato Syn GCaMP6s dTomato Constitutive 1, rg* Ting 68717 pAAV-CAG-Flex-mRuby2...CAG CaMKIIa Dlx EF1a GFAP/GfaABC1D Synapsin E2 regulatory element Activity Cre-dependent Flp-dependent ... GCaMP6f dTomato Constitutive 1, rg* Ting 52924 pZac2.1 gfaABC1D-lck-GCaMP6f GfaABC1D GCaMP6f none Constitutive...