Skip to main content
Addgene
Showing: 401 - 408 of 408 results
  1. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...efficiency than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Browse CRISPR Plasmids By Function Genome...gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert Promoter...gRNA expression plasmid to target the dCas9-repressor to your specific locus. ID Plasmid Gene/Insert Promoter...with a wide variety of Cas-containing plasmids. ID gRNA Plasmid Promoter Cloning Enzyme(s) Validated In...Ampicillin none, need Cas9 plasmid Qi Do you have suggestions for other plasmids that should be added to ... doi: 10.1016/j.bbrc.2013.08.013. Empty gRNA Expression Vectors Select a gRNA expression plasmid based...CRISPR plasmids that have been designed for use in bacteria. CRISPR...
  2. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...SepOTSγ Plasmid 68285 SepOTSδ Plasmid 68286 SepOTSϵ Plasmid 68287 SepOTSζ Plasmid 68288 SepOTSη Plasmid...SepOTSθ Plasmid 68290 SepOTSι Plasmid 68291 SepOTSκ Plasmid 52054 SepOTSµ ( aka. B40 OTS) Plasmid 68294 ...68294 SepOTSν Plasmid 68295 GFP E17TAG Plasmid 68296 GFP S2TAG Plasmid 68297 GFP Q157TAG Plasmid 68298 GFP...Amp) Plasmid 68300 MBP-MEK1 Plasmid 68301 MBP-MEK1 S218TAG Plasmid 68302 MBP-MEK1 S222TAG Plasmid 68305... 68306 C321.ΔA.Δserb.Amp S Plasmid 68292 SepOTSλ Plasmid 68307 SupD Plasmid 34623 SepOTSα SepRS/EF-Sep...pKD-SepRS-EFSep) Plasmid 34624 SepOTSα tRNA-Sep ( aka. pCAT112TAG-SepT) Plasmid 68283 SepOTSβ Plasmid 68284 SepOTSγ...( 188537 ) is a ROP minus plasmid and is not compatible with other plasmids containing high copy ColE1...
  3. Lentiviral Guide

    Type
    Guide
    ...integration. Packaging plasmid(s) Envelope plasmid Addgene’s packaging and envelope plasmids are generalized ...packaging systems Packaging Plasmid All on one plasmid: Gag, Pol, Rev, Tat Two plasmids: one encoding Gag and... 3-4 plasmids are transfected into A293T cells: one transfer plasmid one or two packaging plasmid(s) one...lentiviral transfer plasmids are based on the HIV-1 virus. For safety reasons, transfer plasmids are all replication...and optimize is the transfer plasmid. 2nd generation lentiviral plasmids utilize the viral LTR promoter...within a transfer plasmid: for example, the U6 promoter is included in the pSico plasmid to drive shRNA ...single packaging plasmid encoding the Gag, Pol, Rev, and Tat genes. The transfer plasmid contains the viral...
  4. TALENs for Endogenous Zebrafish Genes

    Type
    Collection
    ...Pre-constructed pairs of TALEN plasmids targeting zebrafish genes....TCACCGGGAACAATGTGCctgcgtttctgaccaaACTCTGGACGCTGGTGGA id2a TAL3100 & TAL3101 TAACGACGACGGAGCACAgtctgggaatctcgcgGAGCAAGACCCCCGTGGA...
  5. Chemogenetics Guide

    Type
    Guide
    ... chemogenetics plasmids available through Addgene, check out our Chemogenetics Plasmid Collection . Figure...Preparations of Chemogenetic Plasmids ! Table 4. Common promoters in chemogenetics plasmids Promoter Cell Specificity...Want to know more about FLEx vectors? Read our Plasmids 101: FLEx Vectors blog! Download our chemogenetics...Addgene's guide to using Chemogenetics plasmids in your lab for interrogation of neuronal activity. Science...the text. Browse Addgene's collection of DREADD plasmids ! PSAMs Unlike DREADDs, which manipulate neuronal... al., 2011 Browse Addgene's collection of PSAM plasmids ! LMOs Luminopsins (LMOs), or luminescent opsins...et al., 2025 Browse Addgene's collection of LMO plasmids ! Planning Your Chemogenetics Experiment If you're...
  6. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Species) Organism/Expression System Plasmids Mammalian Golenbock Lab Plasmids - Includes tagging with CFP, YFP...Lentiviral Plasmids - Fluorescently tag your gene for lentiviral expression Verkhusha Lab Plasmids - Enhanced...Mammalian Plasmids - Includes tagging with mCherry, mCitrine, mCerulean Davidson Lab Plasmids - Includes...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...Addgene has assembled a collection of empty plasmid backbones with different fluorescent tags for you...colors. Addgene has assembled a collection of empty plasmid backbones with different fluorescent tags for you...Emission (nm) Brightness pKa Maturation Structure Plasmids Sirius 355 424 4 3.0 Prone to dimerization Sirius-N1...
  7. Sequencing Primers

    Type
    Guide
    ... For sequencing plasmids in our repository, we've chosen primers based on the plasmid backbone and insert...uses for sequence verification of deposited plasmids. Plasmid... Plasmid Reference Molecular Biology Reference Sequencing... useful in your sequencing reaction, find your plasmid page and see what primers are listed under "5' ... for sanger sequence verification of deposited plasmids. Below is a list of commonly used primers. This...GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids, forward primer pCasper-F GGGTTTTATTAACTTACAT ... stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early...
  8. Optogenetics Guide

    Type
    Guide
    ... check out our Biosensors Plasmid Collection . To find optogenetics plasmids available through Addgene...mutagenesis - use Addgene's Optical Switch Plasmid Table to search for plasmids for your next experiment. For a ...domain (iLID plasmid), while its natural binding partner SspB is included in a separate plasmid; Blue light...Addgene's guide to using Optogenetics plasmids in your lab, including explanations of microbial opsin...Addgene, check out our Optogenetics Plasmid Collection . Microbial Opsins Opsins are light-gated ion channels... of opsins here to find the right optogenetics plasmids for your experiments. Channelrhodopsins Channelrhodopsins...SwiChRca, Phobos, Aurora Browse Channelrhodospin plasmids . Halorhodopsins Halorhodopsins are light-gated...
Showing: 401 - 408 of 408 results