We narrowed to 416 results for: plasmids 101
-
TypeCollection...Pre-constructed pairs of TALEN plasmids targeting zebrafish genes....TCACCGGGAACAATGTGCctgcgtttctgaccaaACTCTGGACGCTGGTGGA id2a TAL3100 & TAL3101 TAACGACGACGGAGCACAgtctgggaatctcgcgGAGCAAGACCCCCGTGGA...
-
Addgene's eBook Collection
TypeGuide... Download Select Plasmids 101 September 2023 | Fourth Edition About Plasmids 101 September 2023 ...popular Plasmids 101 blog series, this eBook covers everything you need to know about plasmids, from parts...About Overlay Select CRISPR 101 January 2021 | Third Edition About CRISPR 101 January 2021 | Third...Fluorescent Proteins 101 August 2017 | First Edition About Fluorescent Proteins 101 August 2017 | ... Select Viral Vectors 101 July 2024 | Second Edition About Viral Vectors 101 July 2024 | Second... Select CRISPR 101 en español January 2024 | First Edition, trans. About CRISPR 101 en español January...nuestro libro electrónico, CRISPR 101. Close About Overlay Select Antibodies 101 New! October 2024 | First... -
Educational Resources
TypeGuide.... Titles include: Plasmids 101 CRISPR 101 Viral Vectors 101 Fluorescent Proteins 101 Science Career Guide...Viral Vectors Plasmid Technology Career Readiness Molecular Biology Learn about plasmids, sequencing, ...biology, plasmid cloning, and virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning...include: Protocols Careers How-to Blog Read about plasmids in Addgene’s repository , and related molecular...Concentrations for Bacterial Selection What is a Plasmid? Genetic Code Strain Information Molecular Cloning... -
Cloning
TypeGuide...of interest (YGOI) into a recipient plasmid. (Image from Plasmid 101: Restriction cloning ) Back to Top...Recombination Cloning Gateway cloning (Image from Plasmid 101: Gateway Cloning ) Gateway® cloning is a recombination.... Back to Top TOPO® Cloning TOPO (Image from Plasmid 101: TOPO Cloning ) Toposiomerase based cloning, ...product into a plasmid. The major disadvantage of TOPO® cloning is that very few plasmid backbones are ...Entry plasmids are also available, allowing for rapid cloning of PCR products into donor plasmids without... For more information and tips check out our Plasmid 101 blog post on TOPO cloning. Back to Top Gibson... 5' exonuclease. Gibson Assembly (Image from Plasmid 101: Gibson Assembly ) Back to Top Type IIS Assembly... -
Promoters
TypeGuide...biology basics and plasmid components. Plasmids 101: The Promoter Region-Let's Go Plasmids 101: Inducible Promoters...Promoters Plasmids 101: Repressible Promoters Plasmids 101: Terminators and PolyA signals... popular Plasmids 101 series , covers topics ranging from the newest breakthroughs in plasmid technologies... Plasmid Reference Molecular Biology Reference Promoters... -
Molecular Biology Reference
TypeGuide...Restriction Cloning Plasmids 101: Inducible Promoters Plasmids 101: What is a plasmid? Plasmids 101: Antibiotic...biology basics and plasmid components. Plasmids 101: Origin of Replication Plasmids 101: The Promoter Region-Let...Reference Guide Plasmids 101: 5 factors to help you choose the right cloning method Plasmids 101: Restriction...Molecular Genetics Plasmid Elements Working with Plasmids Introduction Types of Plasmids E. coli strains ...propagating plasmids Antibiotics commonly used for plasmid selection DNA sequencing for plasmid verification...to be studied into the plasmid. Below are some common plasmid elements: Plasmid Element Description Origin...our popular Plasmids 101 series covers topics ranging from the newest breakthroughs in plasmid technologies... -
Modular Cloning Guide
TypeGuide... may also like... Plasmid Kits Blog: Plasmids 101 Modular Cloning Blog: Plasmids 101 Modular Cloning Applications...Applications and Kits Blog: Plasmids 101 Golden Gate Cloning Synthetic Biology Plasmids Modular Cloning (or MoClo...functional plasmids. It is a powerful and very efficient method for creating many plasmids from different...Parrott 48 plasmids compatible with the GreenGate Cloning System (Lohmann) to create plasmids with multi-gene...Expression Tomáš Pluskal Plasmid kit for assembly of single-gene and multigene plasmids for genome integration... with plasmids from the MoClo-YTK . MoClo Pichia Toolkit Yeast Expression Volker Sieber Plasmids with ...NT-CRISPR Plasmid Collection Genome Engineering, CRISPR, Bacterial Expression Anke Becker Plasmids to perform... -
Adeno-associated virus (AAV) Guide
TypeGuide...different plasmid. In order to produce rAAV vectors, three plasmids are needed: Transfer plasmid (also known...the packaging plasmid. For a summary of all AAV plasmid components, see the AAV Plasmid Elements table...addgene.org AAV Plasmids Available at Addgene Viral Vectors 101 eBook Viral Vectors 101 Youtube Videos ...as cis plasmid) — containing the transgene of interest between the two ITRs. Packaging plasmid (also known...chosen plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be ...Production The three production plasmids (transfer, packaging, and helper plasmid) are transfected into cells...Optogenetics 101 video or by visiting Addgene's Optogenetics Guide . Browse optogenetics plasmids available... -
Gamma-Retroviral Vector Guide
TypeGuide...Gamma-Retroviral Plasmid Elements Plasmid Type Element Delivery relative to transgene Purpose Transfer plasmid LTR ... of all gamma-retroviral plasmid components, see the Gamma-Retroviral Plasmid Elements table . In order...gamma-retroviral vectors, you need three plasmids (Figure 2): Transfer plasmid — contains transgene, sgRNA, or ...capacity Packaging plasmid — contains packaging genes gag and pol Envelope plasmid — contains packaging...chosen plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be ...on separate plasmids ( in trans ). This method, therefore, reduces the number of plasmids that are required...different plasmids containing the transfer, envelope, or packaging components. The transfer plasmid encodes... -
Adenovirus Guide
TypeGuide...you generally need two plasmids: Shuttle plasmid (also known as transfer plasmid) — containing the transgene...shuttle plasmid. For a summary of all adenoviral plasmid components, see the Adenoviral Plasmid Elements...for recombination with the adenoviral plasmid. Adenoviral plasmid — containing the rest of the adenoviral...chosen plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be ...consists of two plasmids that eventually recombine to form one: Shuttle/transfer plasmid (e.g. pAdTrack...backbone plasmid containing the adenoviral genes necessary for virus production. The shuttle plasmid and the...shuttle plasmid, but this method results in a higher background of non-recombinant adenoviral plasmids. Recombinant... -
Lentiviral Vector Guide
TypeGuide...second-generation transfer plasmids as well. Third-generation plasmids include (Figure 4): Transfer plasmid — contains...Packaging plasmid 1 — contains gag and pol Packaging plasmid 2 — contains rev Envelope plasmid — contains...systems Packaging Plasmid One plasmid encoding gag , pol , tat , and rev Two plasmids, one encoding gag...Lentiviral Plasmid Elements Plasmid Type Element Delivery relative to transgene Purpose Transfer plasmid LTR ...separated into distinct plasmids for safety. For a summary of all lentiviral plasmid components, see the ...four, for third generation) plasmids: Transfer plasmid — contains transgene, sgRNA, or shRNA of interest ...rev ; separated into two plasmids in third generation systems Envelope plasmid — contains packaging gene... -
CRISPR Guide
TypeGuide...editing CRISPR 101: Homology directed repair CRISPR 101: Validating your genomic edit CRISPR 101: Multiplex...Blog References Website CRISPR plasmids and resources at Addgene CRISPR 101 eBook (3rd edition) CRISPR software...Addgene's guide to using CRISPR plasmids in your lab, from knockouts to pooled library screening. Science... cell must be validated experimentally. Browse Plasmids: Double-Strand Break (Cut) Multiplex Genome Engineering...cases, delivering multiple gRNAs using a single plasmid ensures that all gRNAs will be expressed in the...likelihood that any cell containing the CRISPR plasmid will have all desired genomic edits carried out...genetic loci by cloning multiple gRNAs into a single plasmid — though some have achieved targeting in the double... -
Chemogenetics Guide
TypeGuide... chemogenetics plasmids available through Addgene, check out our Chemogenetics Plasmid Collection . Figure...Preparations of Chemogenetic Plasmids ! Table 4. Common promoters in chemogenetics plasmids Promoter Cell Specificity...Want to know more about FLEx vectors? Read our Plasmids 101: FLEx Vectors blog! Download our chemogenetics...Addgene's guide to using Chemogenetics plasmids in your lab for interrogation of neuronal activity. Science...the text. Browse Addgene's collection of DREADD plasmids ! PSAMs Unlike DREADDs, which manipulate neuronal... al., 2011 Browse Addgene's collection of PSAM plasmids ! LMOs Luminopsins (LMOs), or luminescent opsins...et al., 2025 Browse Addgene's collection of LMO plasmids ! Planning Your Chemogenetics Experiment If you're... -
Plan Your Experiment
TypeGuide...design. Addgene offers many plasmids containing validated gRNAs . These plasmids contain gRNAs that have ...generate stable cell lines if your plasmid contains a selection marker. Plasmid delivery is versatile thanks...Application Cas Enzyme Additional Considerations Browse Plasmids Knockout Permanently disrupt gene function; cells...different activator systems exist, including the multi-plasmid SAM system Activate Design and Clone Your gRNA ..., anneal, and insert the targeting oligos into plasmids containing the gRNA scaffold using standard restriction-ligation...review the protocol associated with the specific plasmid in question (see CRISPR protocols from Addgene ...the expression time (transient or stable). For plasmid and viral-based approaches, the species and expression... -
Optogenetics Guide
TypeGuide... check out our Biosensors Plasmid Collection . To find optogenetics plasmids available through Addgene...mutagenesis - use Addgene's Optical Switch Plasmid Table to search for plasmids for your next experiment. For a ...domain (iLID plasmid), while its natural binding partner SspB is included in a separate plasmid; Blue light...Addgene's guide to using Optogenetics plasmids in your lab, including explanations of microbial opsin...Addgene, check out our Optogenetics Plasmid Collection . Microbial Opsins Opsins are light-gated ion channels... of opsins here to find the right optogenetics plasmids for your experiments. Channelrhodopsins Channelrhodopsins...SwiChRca, Phobos, Aurora Browse Channelrhodospin plasmids . Halorhodopsins Halorhodopsins are light-gated... -
Sequencing Primers
TypeGuide... For sequencing plasmids in our repository, we've chosen primers based on the plasmid backbone and insert...uses for sequence verification of deposited plasmids. Plasmid... Plasmid Reference Molecular Biology Reference Sequencing... useful in your sequencing reaction, find your plasmid page and see what primers are listed under "5' ... for sanger sequence verification of deposited plasmids. Below is a list of commonly used primers. This...GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids, forward primer pCasper-F GGGTTTTATTAACTTACAT ... stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early...