Skip to main content

We narrowed to 460 results for: nsf

Showing: 441 - 460 of 460 results
  1. Protocol - How to Streak a Plate

    Type
    Protocol
    ...also like... Making LB Agar Plates Bacterial Transformation Recovering Plasmid DNA from Bacterial Culture...
  2. Fluorescence Titering Assay

    Type
    Protocol
    ...brands and lots of FBS can promote or inhibit transfection. Test a variety of brands and lots of FBS to...
  3. Gibson Assembly Protocol

    Type
    Protocol
    ...You can purchase master mix or make your own. Transform bacteria with the DNA and screen for the correct...
  4. Immunocytochemistry

    Type
    Protocol
    ...you know expresses the protein, such as cells transfected with a plasmid to express the protein of interest...
  5. Colony Formation Titering Assay

    Type
    Protocol
    ...brands and lots of FBS can promote or inhibit transfection. Test a variety of brands and lots of FBS to...
  6. Lentiviral Vector Guide

    Type
    Guide
    ...second-generation transfer plasmids as well. Third-generation plasmids include (Figure 4): Transfer plasmid — ...three or four) are transfected into HEK293T cells using your preferred transfection method. The HEK293T...activate the promoter on the transfer plasmid. Many of the lentiviral transfer plasmids that have been deposited...three (or four, for third generation) plasmids: Transfer plasmid — contains transgene, sgRNA, or shRNA ... First-generation plasmids include (Figure 2): Transfer plasmid — contains transgene and wild-type LTRs...tat , as the 5’ LTR is used as a promoter on the transfer plasmid, and this requires Tat for activation....Second-generation plasmids include (Figure 3): Transfer plasmid — contains transgene and wild-type LTRs...
  7. Adenovirus Guide

    Type
    Guide
    ...possibility that recombination between the transfected adenoviral transfer plasmid and the E1 region integrated...need two plasmids: Shuttle plasmid (also known as transfer plasmid) — containing the transgene of interest...transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with most standard cloning...restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction sites or...recombination of unstable regions, like the ITRs found in transfer plasmids. This will ensure that the repeats will...that eventually recombine to form one: Shuttle/transfer plasmid (e.g. pAdTrack) — containing the transgene...restriction enzyme PmeI . This construct is then transformed into AdEasier-1 cells (Addgene #16399) , which...
  8. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...three production plasmids (transfer, packaging, and helper plasmid) are transfected into cells which then ...produce rAAV vectors, three plasmids are needed: Transfer plasmid (also known as cis plasmid) — containing...transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with most standard cloning...restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction sites or...recombination of unstable regions, like the ITRs found in transfer plasmids. This will ensure that the repeats will...rare possibility that recombination between the transfected plasmids could lead to the production of replication-competent...longer transgene is broken down between two AAV transfer plasmids and packaged in separate rAAV vectors...
  9. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...described above (envelope, packaging, and transfer) are co-transfected into the HEK293T packaging cell line...plasmids containing the transfer, envelope, or packaging components. The transfer plasmid encodes the gene...gamma-retroviral vectors, you need three plasmids (Figure 2): Transfer plasmid — contains transgene, sgRNA, or shRNA ...transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with most standard cloning...restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction sites or... number of plasmids that are required in the transfection step of the viral packaging cell line. For example...events occur between the packaging, envelope, and transfer plasmids, and that resulting construct is packaged...
  10. Plan Your Experiment

    Type
    Guide
    ...efficiently transfect. However, note that this method is most useful for cell lines that you can transfect at ...CRISPR system into mammalian cells is to directly transfect expression plasmids encoding your Cas protein ...gRNA, which you generally perform by chemical transfection or electroporation. Expression can be transient...Lentiviral vectors are a good option for difficult-to-transfect cells. You can direct expression to specific cell...These methods are more transient than plasmid transfection or viral vectors, reducing the risk of accumulating...method is helpful in cells that are difficult to transfect, transduce, or may not express common promoters...
  11. Modular Cloning Guide

    Type
    Guide
    ...E. coli to maintain the final plasmid after transformation. Figure 1: Overview of the MoClo Toolkit components...multigene constructs. MoClo Plant Parts III: Transformation & Genome Engineering Kit Plant Expression, ...plasmids with multi-gene constructs for plant transformation. GoldenBraid 2.0 Kit Plant Expression, CRISPR...Daniel Voytas 76 plasmids for assembling plant transformation vectors for overexpression, gene editing, functional... expression vectors for transient or stable transfections. PUF Assembly Kit Mammalian Expression, Bacterial...
  12. Molecular Cloning Techniques

    Type
    Guide
    ... with four nicks that bacteria repair after transformation. LIC does not require site-specific recombination... is rendered unnecessary. The product may be transformed directly into E. coli , where the normal replication... recombination abilities of yeast. By simply transforming into yeast two (or more) fragments of dsDNA ... seamless manner. To accomplish this, you can transform into yeast the fragments of DNA to be fused along...
  13. CRISPR Guide

    Type
    Guide
    ...libraries are a heterogeneous population of lentiviral transfer vectors. In most cases, each plasmid contains ...then cloned in a pooled format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector...short 3′ overhang, allowing for directional gene transfer, which may increase the efficiency of gene editing... Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers...
  14. Sequencing Primers

    Type
    Guide
    ...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward pGP704-R AACAAGCCAGGGATGTAACG R6K gamma...
  15. Antibody Guide

    Type
    Guide
    ...hybridoma cells into plasmids. Plasmids are then transfected into cells and induced to express antibodies.... an SDS-PAGE gel to separate proteins by size. Transfer proteins from the gel to a membrane. Incubate ...
  16. Educational Resources

    Type
    Guide
    ...virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating Bacterial Glycerol...
  17. Addgene's eBook Collection

    Type
    Guide
    ...and management, resources for identifying your transferable skills, and tips on the job application process...
  18. Promoters

    Type
    Guide
    ...RNA polymerase III — transcribes genes encoding transfer RNAs (tRNA), the adaptor molecules that are responsible...
  19. Molecular Biology Reference

    Type
    Guide
    ...bacterium to another by a type of horizontal gene transfer called conjugation. Like chromosomal DNA, plasmid...
Showing: 441 - 460 of 460 results