Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 818 results for: cell

Showing: 721 - 750 of 818 results

  1. Antibodies 101: Stripping and Reprobing Western Blots

    Type
    Blog Post
    ...protein of interest in a complicated solution like cell lysate. But they can be a lot of work — and what...better than a nitrocellulose membrane. If you have already run your blot using nitrocellulose, you may decide...instructions for the membrane you are using. Dry nitrocellulose membranes are brittle, so proceed with caution...

  3. To Each HIS Own

    Type
    Blog Post
    ...This can be pretty complicated given that a single cell has tens of thousands of proteins functioning in...

  5. Science Guides

    Type
    Guide
    ...receptors to selectively control and investigate cell signaling pathways. Receptors are remotely controlled...and genetic engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular...detect, measure, and control molecular signals and cells in order to understand their functions. Read More...

  8. Lab Automation at Addgene

    Type
    Blog Post
    ...our set up. The cooling block is used to keep our cells from warming up too much and dying.  Also, we added...

  9. 6 Tips for Grant Writing

    Type
    Blog Post
    ...Cambridge University where he studied mechanisms of cell division. Recently Seán got the entrepreneurial ...research (either because of expertise, equipment, or excellence of the institution). Likewise, if you’re staying...

  10. Progress Towards a PAM-Free CRISPR

    Type
    Blog Post
    ...Precise and efficient scarless genome editing in stem cells using CORRECT. Nat Protoc 12, 329–354 (2017). DOI...

  12. Promoters

    Type
    Guide
    ...describes the specifics of these regions in eukaryotic cells. Core Promoter The core promoter region is located...bind. Histones are proteins found in eukaryotic cells that package DNA into nucleosomes. Histone binding...element controls the rate of transcription. Bacterial cells contain sigma factors which assist the RNA polymerase...ribosomal RNA (rRNA) which is a main component of a cell’s ribosome structure. Ribosomes are the site of protein...

  14. Transferable Skills: Negotiation

    Type
    Blog Post
    ...request? Your colleague is if someone can feed their cells this weekend - why? Do they have an important plans...

  16. Academic vs. Industry Postdocs

    Type
    Blog Post
    ...Scientist at AstraZeneca. She has a background in cell and developmental biology and is applying this towards...

  17. Anatomy of a Plasmid Page at Addgene

    Type
    Blog Post
    ...such as some of our viral vectors, in NEB Stable cells. Resource information: This section contains information...analyzed using Addgene’s Analyze Sequence tool. Excellent, how can I check if the plasmid will be within...

  19. Sequencing Primers

    Type
    Guide
    ...Murine stem cell virus, forward primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus, reverse...CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC...pLXSN 5' CCCTTGAACCTCCTCGTTCGACC (MSCV) Murine stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT...

  20. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...R-mAbs plasmids, production of R-mAbs in transfected cells and their validation can be found below. With these...transfecting the plasmids into mammalian tissue culture cells (e.g., HEK293, COS, CHO), from which the R-mAbs ...level expression we recommend using the HEK-2936E cell line engineered by Durocher et al., 2002 (Link opens...used to produce R-mAbs from transfected mammalian cells. Addgene ID Plasmid Target Target Species Host Species...Pink1 Human M. musculus (mouse) IgG2b 227033 SynCAM1 cell adhesion molecule (Mus musculus) recombinant mouse...used to produce scFvs from transfected mammalian cells. Addgene ID Plasmid Hybridoma Target Target Species...to produce nanobodies from transfected bacterial cells. Addgene ID Plasmid Hybridoma Target Target Species...

  24. Career Insights: Technical Support Specialist

    Type
    Blog Post
    ...issue was with a custom-made reagent to manipulate cells (manufactured by one of the larger biotech companies...Specifically, roles in technical support make excellent use of the skills developed by life science PhDs...about novel developments in the fields of gene and cellular therapies.     Additional Resources on the Addgene...

  26. Light Sheet Fluorescence Microscopy

    Type
    Blog Post
    ... Weber, M. Mickoleit, J. Huisken. (2014) Methods Cell Biol.123, 193-215. Pubmed. W. Spalteholz. (1914)...transparent are enabling microscopes to visualize the cellular architecture of whole tissues in 3D with unprecedented...

  27. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Cas protein and a target-specific gRNA in the same cell at the same time. Single plasmids containing both...Alternatively, gRNA-only plasmids can be used in cells or organisms in which Cas9 has been integrated into...

  30. Using Video to Share Your Science: We Share Science

    Type
    Blog Post
    ... the 926 video abstracts identified. The journal Cell had the largest average view count per video abstract.../wesharescience.com/pin/7472 Article: http://www.cell.com/current-biology/abstract/S0960-9822(16)30873...
Showing: 721 - 750 of 818 results