...genre fiction novella as it does to read an 11-page Cell paper - and sometimes, it might actually take me...

...following panel members: Jonathan Dinman, Chair of the Cell Biology and Molecular Genetics Department at University...

...Murine stem cell virus, forward primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus, reverse...CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC...pLXSN 5' CCCTTGAACCTCCTCGTTCGACC (MSCV) Murine stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT...

...Precise and efficient scarless genome editing in stem cells using CORRECT. Nat Protoc 12, 329–354 (2017). DOI...

...for Light and Electron Microscopy. In Methods in Cell Biology (pp. 283–310). Elsevier. https://doi.org...

... Innovative Neurotechnologies (BRAIN) Initiative Cell Census Network, the Wu lab will be screening over...

...our set up. The cooling block is used to keep our cells from warming up too much and dying.  Also, we added...

...Cambridge University where he studied mechanisms of cell division. Recently Seán got the entrepreneurial ...research (either because of expertise, equipment, or excellence of the institution). Likewise, if you’re staying...

...with appropriate flanking homology into a germline cell can create an RNA-guided gene drive. In principle...

...Promoters: Select the best promoter for your target cell type Serotype: Choose the AAV capsid or lentiviral...

...Scientist at AstraZeneca. She has a background in cell and developmental biology and is applying this towards...

...compelling photos and videos, while molecular, micro, and cell biology are often more suited for cartoons or graphics...

...request? Your colleague is if someone can feed their cells this weekend - why? Do they have an important plans...

...such as some of our viral vectors, in NEB Stable cells. Resource information: This section contains information...analyzed using Addgene’s Analyze Sequence tool. Excellent, how can I check if the plasmid will be within...

...really easy to clone genes for expression in plant cells. Sylvester and I chose the 96 most useful things...

...visible whether expressed in E. coli, in mammalian cells, or in purified form, and didn’t need any added ...

...the mesocorticolimbic system in addiction. Front Cell Neurosci. 2014;8:466. PubMed PMID: 25653591. PubMed...

...used in the detection of rare sequences and single cell analysis. It is also being used in the detection...

...attend. Societies, such as the American Society for Cell Biology (ASCB) or the American Chemical Society ...

...issue was with a custom-made reagent to manipulate cells (manufactured by one of the larger biotech companies...Specifically, roles in technical support make excellent use of the skills developed by life science PhDs...about novel developments in the fields of gene and cellular therapies.     Additional Resources on the Addgene...

... Weber, M. Mickoleit, J. Huisken. (2014) Methods Cell Biol.123, 193-215. Pubmed. W. Spalteholz. (1914)...transparent are enabling microscopes to visualize the cellular architecture of whole tissues in 3D with unprecedented...

...including those for preparing your own competent cells. If you’re familiar with the process of creating...

...R-mAbs plasmids, production of R-mAbs in transfected cells and their validation can be found below. With these...transfecting the plasmids into mammalian tissue culture cells (e.g., HEK293, COS, CHO), from which the R-mAbs ...level expression we recommend using the HEK-2936E cell line engineered by Durocher et al., 2002 (Link opens...used to produce R-mAbs from transfected mammalian cells. Addgene ID Plasmid Target Target Species Host Species...Pink1 Human M. musculus (mouse) IgG2b 227033 SynCAM1 cell adhesion molecule (Mus musculus) recombinant mouse...used to produce scFvs from transfected mammalian cells. Addgene ID Plasmid Hybridoma Target Target Species...to produce nanobodies from transfected bacterial cells. Addgene ID Plasmid Hybridoma Target Target Species...

...Cas protein and a target-specific gRNA in the same cell at the same time. Single plasmids containing both...Alternatively, gRNA-only plasmids can be used in cells or organisms in which Cas9 has been integrated into...

...Most housekeeping proteins are highly expressed in cells. This means that at sample concentrations appropriate...

...ability to establish and maintain itself within host cells.  The plasmid has multiple ori that are functionally...eutrophus, Bartonella bacilliformis, Bordetella spp., Brucella spp., Caulobacter crescentus, Escherichia coli...

... the 926 video abstracts identified. The journal Cell had the largest average view count per video abstract.../wesharescience.com/pin/7472 Article: http://www.cell.com/current-biology/abstract/S0960-9822(16)30873...

...Optogenetics AAV Optogenetic tools can be used to control cell activity in living tissue with light. Optogenetics...

... of Cre, and expresses NLS-EGFP in Cre-positive cells. Control Harvey 137164 pAAV-nEF-Con/Fon/Von eYFP...

...homology-directed repair (HDR) pathway which occurs in cells at low frequencies and relies on the efficient delivery...Later the resultant U-G pair is either repaired by cellular mismatch repair machinery making an original C-G...’ to ‘I’ (inosine), which is treated as ‘G’ by cellular polymerases. Subsequently, an original genomic... is converted to a G-C pair (Figure 1). As the cellular inosine excision repair is not as active as uracil...