We narrowed to 541 results for: SHI
-
TypeGuide... K, Ji B, Takahashi M, Huang X-P, Slocum ST, DiBerto JF, Xiong Y, Urushihata T, Hirabayashi T, Fujimoto..., Jin J (2015). The First Structure–Activity Relationship Studies for Designer Receptors Exclusively Activated...English JG, Liu J, Inoue K, Kumata K, Seki C, Ono M, Shimojo M, Zhang M-R, Tomita Y, Nakahara J, Suhara T, Takada...
-
A History of Genome Engineering in Popular Culture
TypeBlog Post...were space and robots. Warping to stars in space ships and the rise of killer machines that exterminate... -
FLEx Technology and Optogenetics: Flipping the switch on gene expression with high spatial and temporal resolution
TypeBlog Post...manager at genOway. Acknowledgement:Through a partnership with genOway, we are able to distribute materials... -
Deep Dive: Statistical Tests (Comparisons)
TypeBlog Post... of comparisons. The Bonferroni does this by establishing a significance threshold at a p value less than... -
Important Considerations When Using AAVs
TypeBlog Post...gene delivery in an efficient and non-pathogenic fashion. Work improving AAV tissue tropism, transduction... -
Tips for a 1st Time CRISPR User (by a 1st Time CRISPR User)
TypeBlog Post..., which I’d say is pretty amazing. Despite the shifting landscape of research opportunities, it’s an exciting... -
Sequencing Options for CRISPR Genotyping
TypeBlog Post...genotyping, is critical to demonstrating causal relationships between genotype and assayed phenotype. Verifying... -
Hassle-free 96-well Format Epitope Tagging Using Cas9 Ribonucleoprotein
TypeBlog Post...primers flanking the tag sequence and expect a size-shift in the PCR product for knock-in lines. Troubleshooting... -
Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins
TypeBlog Post...appropriate containers. The machine is useful for distinguishing cell populations that have been tagged with... -
CRISPR 101: Multiplex Expression of gRNAs
TypeBlog Post...plasmids from this paper at Addgene. 3. Sakuma, Tetsushi, et al. “Multiplex genome engineering in human... -
Antibody Validation for Flow Cytometry
TypeBlog Post... of an orthogonal approach to understand the relationship between antibody staining intensity by flow ... -
The CRISPR Software Matchmaker: A New Tool for Choosing the Best CRISPR Software for Your Needs
TypeBlog Post...software. This category is important for users wishing to select tools based on their comfort level with... -
Delivery Methods for Generating iPSCs
TypeBlog Post...Masayuki, Minoru Iijima, Manami Ohtaka, and Mahito Nakanishi. "Novel Strategy to Control Transgene Expression... -
Deep Dive: qPCR
TypeBlog Post...Huggett J; Kubista M; Mueller R; Nolan T; Pfaffl MW; Shipley GL; Vandesompele J; Wittwer CT. The MIQE guidelines... -
CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More
TypeBlog Post...bacterial CRISPR engineering One common way of accomplishing bacterial genome engineering is done with recombineering... -
Plan Your Experiment
TypeGuide...mRNA due to alternative splicing, and an early frameshift mutation is more likely to result in a non-functional....org/10.1038/s41587-020-0490-7 PMID: 29305085 Hashimoto, M., & Takemoto, T. (2015). Electroporation enables... -
Antibody Guide
TypeGuide...price, and other factors like availability and shipping time. Choose antibodies from companies that are...several to compare, or select one based on price, shipping availability, ease of purchase, or similar factors... -
Sequencing Primers
TypeGuide...-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP vs EYFP, reverse primer F1ori-... -
Adenovirus Guide
TypeGuide...24533227 (Link opens in a new window) Watanabe, M., Nishikawaji, Y., Kawakami, H., & Kosai, K. I. (2021). Adenovirus... -
Molecular Biology Reference
TypeGuide..., and thus the plasmid exists in a symbiotic relationship with the host cell. Like the bacterial chromosomal...