We narrowed to 568 results for: bli
-
TypeBlog Post...proteins are excited by 750 nm to 760 nm laser light, enabling dual color imaging studies with blue or cyan proteins...
-
Custom CRISPR Screens & the Green Listed Software
TypeBlog Post...like to use in your screen. Currently, eleven published libraries are embedded. These were kindly donated... -
Typing CRISPR Systems
TypeBlog Post... use in mammalian systems, with the landmark publication in 2013. Since that point, it has become the ... -
Illuminating Choices: A Guide to Selecting Fluorescent Dyes and Ligands
TypeBlog Post...495/517 nm. FITC binds to an amine on a protein, enabling the labeling of protein substrates/peptides and... -
A Primer on Optogenetics: Introduction and Opsin Delivery
TypeBlog Post...the many primary research papers that have been published at this point. In brief, some standard opsins... -
CRISPR 101: Cytosine Transversion Editors
TypeBlog Post...around the same time. (The papers were actually published in the same journal on the same day.) This team... -
A Needle in a Base-Stack: Cas9 Structural Biology
TypeBlog Post...different techniques all bring their own advantages—and blind spots—to these questions. Each new structural insight... -
Genetic Code Expansion
TypeCollection...consider. If you are working off of a previously established protocol, make sure to match the growth medium...changes to UAG, RF1 function removed, improved doubling time. George Church 98564 C321.Ub-UAG-sfGFP all... -
Validated gRNA Sequences
TypeCollection...TATGTTGGTGACTTGCCTCC 58782 cut S. pyogenes 24954249 Yamamoto BLIMP1 H. sapiens CGGATGGGGTAAACGACCCG 59724 cut S. pyogenes...be added to this table from any peer reviewed publication. To add validated gRNA sequences to our datatable... -
Brain Initiative Collection
TypeCollection...development and application of innovative tools enabling large-scale real-time interrogation and monitoring...or when BRAIN Initiative grants are noted in publications associated with Addgene materials. Plasmids ... -
Antibody Guide
TypeCollection...short peptide linkers. Diabodies can be used for assembling protein nanostructures. Figure 2: An antibody...specific to your antibody and assay may already be published. If it is not, you’ll need to validate the antibody... -
Using AAV for Neuronal Tracing
TypeBlog Post...advantage of AAV vectors is that there are well-established protocols for their production and purification... -
Modular Cloning Guide
TypeGuide...Cloning (or MoClo) is a system for efficiently assembling multiple DNA parts into functional plasmids. ...genetic circuits, engineering metabolic pathways, assembling gene-editing tools, and more. The MoClo system...Sylvestre Marillonnet 95 plasmids for cloning and assembling standardized parts to create eukaryotic multigene...Plant Expression Daniel Voytas 76 plasmids for assembling plant transformation vectors for overexpression...Plant Expression Benjamin Field 50 plasmids for assembling bimolecular fluorescence complementation experiments...Dueber) for genetic engineering of S. cerevisiae , enabling larger multi-gene constructs, multiplexed CRISPR...and acceptor vectors for generating multi-part assemblies in either integrative or self-replicating plasmid... -
Fluorescent Protein Guide: Biosensors
TypeCollection...ion indicators FR-GECO1 Robert Campbell Lab (unpublished) Robert Campbell Calcium Yellow protein calcium...below or search for a biosensor by name, target, publication title or keywords (e.g. "RCaMP", "caspase", "... -
Zinc Finger Consortium Reagents
TypeCollection... Lab plasmids The Zinc Finger Consortium was established to promote continued research and development... -
KLF Research Plasmids
TypeCollection...efforts within the KLF community have lead to the establishment of this shared resource on Addgene. If you have... -
NETRF
TypeCollection...encourages its funded scientists to make their published materials and resources available to academic ... -
CRISPR Plasmids - RNA Editing
TypeCollection...systems. Mammalian ID Plasmid Gene/Insert PI Publication Do you have suggestions for other plasmids that... -
Cancer Research Plasmids and Resources
TypeCollection... described in the initial Target Accelerator publications, focused on somatic variants found in lung adenocarcinoma... -
CRISPR Plasmids for Genomic Visualization
TypeCollection...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have suggestions for other plasmids that...