Skip to main content
Addgene
Showing: 101 - 131 of 131 results
  1. Sequencing Primers

    Type
    Guide
    ... Reference Sequencing Primers Sequencing Primers Looking for Primers? The primer sequences listed on the... and see what primers are listed under "5' sequencing primer" and "3' sequencing primer". Still not sure...forward primer Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase, forward primer RVprimer3 CTAGCAAAATAGGCTGTCCC...not distribute primers. For sequencing plasmids in our repository, we've chosen primers based on the plasmid...sure what primer you need? Email us at [email protected] Addgene has used a number of primers for sanger... Reference Page . All listed primers are 5′ to 3′. Commonly Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG...forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward primer LucNrev ...
  2. Plasmids 101: Biotinylation

    Type
    Blog Post
    ...Polymerase Chain Reaction (PCR) by using a biotinylated primer. Biotin can also be enzymatically incorporated ...
  3. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...select the appropriate pair of vector and gene primers from Table 2 of the associated publication which...of sequence homology between the vector and gene primer for SLIC cloning. Amplify the pCoofy vector and...
  4. Molecular Biology Reference

    Type
    Guide
    ... plasmid. For commonly used primers check out Addgene's sequencing primer list. Working with Plasmids ...enzyme, the template DNA to be copied, and a primer. A primer is a small piece of DNA, approximately 18-...select or sort the cells by visualization or FACS). Primer Binding Site A short single-stranded DNA sequence...amplification or DNA sequencing of the plasmid. Primers can be utilized to verify the sequence of the insert...know some of its sequence to design a effective primer. Sanger sequencing chromatogram Sanger sequencing...replication, the Sanger sequencing reaction begins when a primer binds to its complementary DNA and the DNA polymerase...approximately 500-1000 bases downstream of the known primer region with very few errors making it an efficient...
  5. Lentiviral Guide

    Type
    Guide
    ...accomplished by PCR amplifying the insert sequence using primers that contain the restriction sites needed. Functional...a certain number of bases from the ends of the primers used. Alternatively, you could ligate a multiple...
  6. CRISPR Guide

    Type
    Collection
    ...flap. However, the longer pegRNA also encodes a primer binding site (PBS) and the desired edits on a RT...gRNA; a specialized gRNA containing an additional primer binding site and reverse transcription template...
  7. Cloning

    Type
    Guide
    ...Complementary overhangs are built into the PCR primers for the insert, based on the destination vector...
  8. Plan Your Experiment

    Type
    Guide
    ... region of interest can be PCR amplified using primers that (A) flank the region of interest (deletions...
  9. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...encodes a unique restriction enzyme site and unique primer sites for more rapid screening by restriction digest...
  10. CRISPR Guide

    Type
    Guide
    ...flap. However, the longer pegRNA also encodes a primer binding site (PBS) and the desired edits on a RT...gRNA; a specialized gRNA containing an additional primer binding site and reverse transcription template...
  11. CRISPR 101 eBook...en español

    Type
    Blog Post
    ...¡La primera edición de nuestro libro electrónico CRISPR 101 ya está disponible en español! Esta traducción...
Showing: 101 - 131 of 131 results