We narrowed to 1,033 results for: CAT;
-
TypeBlog Post...scientists have long used antibody based affinity purification and mass spectrometry approaches. Recently however...that are tagged with biotin using avidin coated purification techniques. Due to the high affinity of biotin...challenge for classic antibody based affinity purification/mass spectrometry methods. BioID: a promiscuous...can even target BirA* to specific subcellular locations, such as the nuclear envelope, allowing scientists...scientists to probe interactions in locations of interest. Try BioID for your proximity labeling experiment... proximity labeling (Rhee et al., 2013). APEX catalyzes the oxidation of biotin-phenol to the short-lived...mutation (R40G) in a conserved residue in the biotin catalytic domain to allow for promiscuous biotinylation....
-
Opto-Nanobodies: Using Light to Manipulate Cell Signaling and Protein Purification
TypeBlog Post...#1: Affinity tag purification You tag YFP and use an affinity column for purification. After binding YFP... Light controlled protein purification with OptoNBs The first application for OptoNBs takes us in vitro...light-controlled affinity purification of unmodified proteins. Affinity purification methods typically require...It’s time to choose your own protein purification adventure. You want to purify your favorite protein...elute YFP. Option #2: Opto-Nanobodies (OptoNBs) purification You skip adding a tag to YFP and instead use...sound like fiction, but light-controlled protein purification is now a reality thanks to OptoNBs. Recently...response to light allows for tagless protein purification as well as reversibly regulation of endogenous... -
Measuring Kinase Activity at the Single-Cell Level with Kinase Translocation Reporters (KTRs)
TypeBlog Post...phosphatase-accessible. Kinase Translocation Reporters (KTRs) Kinase Translocation Reporters (KTRs) are genetically...provides an alternative tool with their Kinase Translocation Reporters (KTRs) whose cellular localization...activity is enhanced, leading to cytoplasmic translocation of the reporter. As a result, the KTR is shuttled...nuclear export and import rates can influence KTR translocation. Work from the Covert lab suggests that these... negligible effect on KTRs, however nuclear translocation rates are another variable to consider when ...measurements of kinase activity in single cells using translocation reporters. Nature protocols, 13 1, 155-169. ... -
Scientific Peer-review: Providing Critical and Kind Feedback and Advocating for Open Science
TypeBlog Post... to help decide whether work is suitable for publication in their journal. The early peer-review attempts...information that would prevent the study to be replicated or omission from the literature. I think that...Addgene.org Learn about depositing plasmids pre-publication Find molecular biology protocols Find eBooks ... -
AAV Molecular Tools
TypeCollection...pAAV-DIO-EF1α-mKate2-PDE4D3-Cat EF1a-driven, Cre-dependent Cre-dependent expression of mKate2 and a truncated human PDE4D3... Tools for Affinity Purification These AAV encode tools for affinity purification (which can be used for...tet-off transactivators and tools for affinity purification (TRAP). Viral... Tools Tetracycline Transactivators Affinity Purification Neurophysiology Cell Ablation Genome Engineering...offers you even more options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral... -
Arabidopsis in Education: How the Arabidopsis Biological Resource Center Brings Plant Science to Life
TypeBlog Post... Our education partnerships have grown to include local school districts, professional education associations...contributed by guest blogger Courtney Price, the Education & Outreach Specialist for the Arabidopsis Biological...resources for Arabidopsis and related species. Located at The Ohio State University in Columbus, Ohio,... more than 100,000 samples to researchers and educators in 60 countries each year. Introducing Arabidopsis...outreach program kicked off with the release of 20 education kits designed for use in K-12 and college-level...Translating Research on Arabidopsis Into a Network of Educational Resources). Arabidopsis is used in research to...blogger, Courtney Price! Courtney Price is the Education & Outreach Specialist for the Arabidopsis Biological... -
Hot Plasmids - March 2019 - Anti-CRISPR, 2in1 Cloning, Fluorescent Voltage Indicators, and Photoswitchable Proteins
TypeBlog Post...voltage indicator Archon Article contributed by Shreya Vedantam Listen to the voltage indicator podcast... genetically encoded voltage indicators. To expand the voltage indicator toolbox, Ed Boyden’s lab developed...customized for protein visualization, relocation, degradation, modification, and scaffolding. In their study...xCas9, and requires no additional chemicals or modifications. This versatility opens up the potential for...Archon1, a novel opsin-based fluorescent voltage indicator. Archon1 can embed itself into the cell membrane...response to blue light (445nm). The discovery and applications of protein partners that bind to only the light... -
Early Career Researcher Toolbox: Social Media for Scientists
TypeBlog Post... writing for the Addgene blog, sharing Chemistry Cat memes was how I used social media as a scientist....needed to start using Twitter. Sharing Chemistry Cat memes use to be how I used social media as a scientist...remotely as an Addgene Science Communication Intern. Developing science communication skills, while also learning... on a panel about “Social Media for Science Communication” at the American Society for Cell Biology (ASCB...Twitter Learn about using Reddit for science communication ... -
Technologies Enabled by NanoLuc® Luciferase
TypeBlog Post...GpNLuc and OgNLuc are available through Addgene (Cat.# 70185 and 70186, respectively). Antares Chu, J...construct for Antares is available through Addgene (Cat. # 74279). Enhanced Nano-Lanterns Suzuki, K., et...et al (2). In this post, I’ll cover two great applications of the NLuc technology. The first couples NLuc...fluorescence. The paper reports a wide variety of applications of the Enhanced Nano-Lanterns including monitoring...2017) Genetically encoded bioluminescent voltage indicator for multi-purpose use in wide range of bioimaging... -
Cultivating Community Science at BosLab
TypeBlog Post...Experimenting in an Open Source Lab: from CRISPR to Cats Stem Cell Models for Disease & Open Science: Interview...state of Massachusetts. Because we’re conveniently located next to a major Biotech hub, building up our lab...pipetting experience. However, after a few months of dedicated time at BosLab, he became our bacterial transformation...projects range from hacking probiotics to filming educational lab videos, while some are looking to develop...microbial diversity in different soil conditions/locations but to engage the local community (including local...Order Plasmids from Addgene! Find Free and Open Educational Resources at Addgene! ... -
The Crispr Babies Saga Shows the Need for Action, Not More Delays
TypeBlog Post...) in an old Girl Scout Cookie factory with their cats, Harley and Lexi, and a clutter ofoutdoors-only ...with healthy mitochondria, with the intent to eradicate mitochondrial diseases. The key success of the... -
3 Challenges in Plant Synthetic Biology
TypeBlog Post...found climbing mountains or playing with his two cats. Keira Havens grew up in Hawaii where she was fascinated...biotechnologists face is public perception of genetic modification (GM) and synthetic biology. The mistrust and...cannot build what we do not understand, and the complicated and unique metabolic processes of plants are ... -
Story of a SynBio Startup: RevBio's Epiphany (or Lack Thereof)
TypeBlog Post...found climbing mountains or playing with his two cats. Keira Havens grew up in Hawaii where she was fascinated...plants engineered to detect explosives and rapidly indicate their presence. They are genetically modified ...enjoy and see a future in. And we decided to make education and outreach a cornerstone of our business, because... -
Technique: Probe Phage Genomes for Host Binding Proteins
TypeBlog Post...spending time with her horse, and wondering what her cat is thinking. Find her on Twitter @JessicaSacher. ... whole genome amplification (by a mechanism known as multiple displacement amplification) even in the ...same location that their host colonies grew. If your cells of interest stick to the same location as a...adding methyl groups, glycosyl groups, and other modifications to their bases in order to protect their DNA...DNA from host cell nucleases (4). To further complicate matters, even when sequenced, phage genomes tend...compressed nitrogen gas; this shears DNA at random locations and allows for a given fragment size to be selected... for physical shearing exist as well, such as sonication and needle shearing. Essentially, any method ... -
DNA Quantification
TypeProtocol... Protocols DNA Quantification DNA Quantification You may also like... Addgene’s DNA Quantification Protocol. Protocols... to protein (260/280) is generally used as an indicator of the purity of DNA samples. These days, many... -
CRISPR Library Amplification
TypeProtocol... Protocols CRISPR Library Amplification CRISPR Library Amplification You may also like... Pooled libraries...quantities of library for experimental applications. Repeated amplifications should be avoided as best as possible...Follow this protocol to perform amplification of CRISPR pooled plasmid libraries in Escherichia coli ...refer to our pooled library material pages for amplification protocols that have been developed by the depositor...available. If a pooled library does not yet have an amplification protocol, the following protocol can be used... CRISPR libraries. This protocol allows the amplification of a pooled-plasmid library in Escherichia coli...genes in an organism's genome, for example. Amplification is usually necessary to produce sufficient quantities... -
AAV Purification by Iodixanol Gradient Ultracentrifugation
TypeProtocol.... The arrow indicates the 60–40% interface. The vertical black line indicates the location of the purified... Protocols AAV Purification by Iodixanol Gradient Ultracentrifugation AAV Purification by Iodixanol Gradient...isomolar density gradient medium suitable for virus purification and isolation of cells, organelles, lipoproteins...and use an iodixanol column gradient for AAV purification. Workflow Timeline Day 1: Purify Day 2: Buffer..., et al. "Recombinant adeno-associated virus purification using novel methods improves infectious titer...opens in a new window) . Right panel: cartoon indicating the position of the needle for harvesting of ... -
Plasmid Modification by Annealed Oligo Cloning (with Protocols)
TypeProtocol... Protocols Plasmid Modification by Annealed Oligo Cloning Plasmid Modification by Annealed Oligo Cloning...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...each of the additional sites in tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG...compliment so that they can anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo... final oligos 34 bp each: Top oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3... -
Affinity Purification of Recombinant Antibodies with Protein A or Protein G
TypeProtocol...Affinity Purification with Protein A or Protein G Recombinant Antibody Affinity Purification with Protein... -
Validated gRNA Sequences
TypeCollection...Resources page have been used to indicate the Cas9 application the gRNA was designed to accomplish. Validated...Plasmid ID Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut ...Wolfe LYP1 S. cerevisiae CATAATAACGTCCAATAAAT 60847 cut S. pyogenes 25139909 Cate Mettl14 M. musculus GCCGCTCCCGGATCTCCTGC... sapiens GTTCCGCGTTACATAACTTA 50927 S. pyogenes 24346702 Wolfe Neomycin TCATGGCTGATGCAATGCGG 67594 cut...sapiens TGACATCAATTATTATACAT cut S. pyogenes 26789497 Corn CXCR4 H. sapiens CCTCTTTGTCATCACGCTTC cut S.... sativa CATATAGTTGGGTCATGGCA cut S. pyogenes 26479191 Kim DWD1 O. sativa TGCATCGTCCAAGCGCACAG cut S. pyogenes...upstream of a 5' NGG 3' PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR...