We narrowed to 57 results for: Eomes
-
TypeBlog Post...Furthermore, tumor cells alter their cell-surface proteome to inhibit expression of co-stimulatory molecules...
-
Plant Plasmids and Resources
TypeCollection...Maize Transcription Factor ORFeome - John Gray. Rice Transcription Factor ORFeome - John Gray. Plant transcription... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...Organism Representative Empty Backbones Neomycin (G418) Mammalian, Varies Tet-pLKO-neo - Tet-inducible...selection Find nematode transgenesis plasmids with Neomycin selection Puromycin Mammalian Tet-pLKO-puro - ... -
Antibody Guide
TypeCollection...done using methods such as transcriptomics or proteomics. This approach is often appropriate for quantitative...validation This method uses peptide identification by proteomics (Capture MS) to validate the identity of proteins... -
Resolute Plasmid Collection
TypeCollection...core of the deorphanizing engine. Genetic and proteomic interactions represent the framework that provides... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection...reporter vector expressing firefly luciferase with neomycin resistance. Other Resources Protocols Bloom lab... -
CRISPR Plasmids - Plants
TypeCollection... As Cpf1 Qi 91715 pKEE401 yes, cut S. pyogenes Neomycin Chen Do you have suggestions for other plasmids... -
Lentivirus Plasmids
TypeCollection...Tet-pLKO-neo 3rd inducible expression of shRNA; neomycin selection. See plasmid 21915 for Puro resistance... -
CRISPR References and Information
TypeCollection...cloning gRNA cloning vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) , DsRed (pSIR-DsRed-Express2... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TCAGGCAGTGCAGGCCACcatgatactggccaccATCTTGTGCTGTGTGGGA eomesb TAL3430 & TAL3431 TCTTCTCACCCGGAGGCGgaggaggagaaagtttcTCCGGTAGTTTGTGGTGA... -
Luciferase Plasmid Collection
TypeCollection...destabilized mutants which serve as sensors of proteome stress. pHLuc : An extracellular pH sensor consisting... -
Tetracycline Inducible Expression
TypeCollection...with puromycin selection. See Plasmid #21916 for neomycin selection. TetR H1-2O2 Dmitri Wiederschain 85966... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...multicistronic expression of GFP and/or mCherry, with neomycin cassette Zebrafish, Sea urchin, Xenopus, and C... -
Validated gRNA Sequences
TypeCollection...GTTCCGCGTTACATAACTTA 50927 S. pyogenes 24346702 Wolfe Neomycin TCATGGCTGATGCAATGCGG 67594 cut S. pyogenes 26178787... -
Sequencing Primers
TypeGuide... end of neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance... -
Antibody Guide
TypeGuide...done using methods such as transcriptomics or proteomics. This approach is often appropriate for quantitative...validation This method uses peptide identification by proteomics (Capture MS) to validate the identity of proteins... -
Optogenetics Guide
TypeGuide...Red-shifted chloride-conducting channel from Proteomonas sulcata 540 Phobos Blue-shifted iC++ variant ...