We narrowed to 55 results for: Eomes

...the accuracy of western blots. Expert Review of Proteomics, 11(5), 549–560. https://doi.org/10.1586/14789450.2014.939635...

...fourth-generation DNA sequencing technology." Genomics, proteomics & bioinformatics 13.1 (2015): 4-16. PubMed PMID...

... tagging as a sensitive reporter for tracking proteomic cargo flow via EVs. Find ADAR-HiBiT Fusion Vector...

...https://doi.org/10.1290/1071-2690(2002)038<0086:caeomi>2.0.co;2 Uphoff CC, Drexler HG (2011) Detecting...

...Furthermore, tumor cells alter their cell-surface proteome to inhibit expression of co-stimulatory molecules...

...done using methods such as transcriptomics or proteomics. This approach is often appropriate for quantitative...validation This method uses peptide identification by proteomics (Capture MS) to validate the identity of proteins...

...core of the deorphanizing engine. Genetic and proteomic interactions represent the framework that provides...

...reporter vector expressing firefly luciferase with neomycin resistance. Christopher Vakoc 138152 pLentiEGFPdestablized...

... for puromycin selection, and plasmid 1774 for neomycin selection. Bob Weinberg 10676 pMKO.1 GFP MoMLV...

...cloning gRNA cloning vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) , DsRed (pSIR-DsRed-Express2...

...destabilized mutants which serve as sensors of proteome stress. pHLuc : An extracellular pH sensor consisting...

...with puromycin selection. See Plasmid #21916 for neomycin selection. TetR H1-2O2 Dmitri Wiederschain 85966...

...CGTTGGCTACCCGTGATATT 3' end of neomycin resistance gene Forward Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance ...

...done using methods such as transcriptomics or proteomics. This approach is often appropriate for quantitative...validation This method uses peptide identification by proteomics (Capture MS) to validate the identity of proteins...

...Red-shifted chloride-conducting channel from Proteomonas sulcata 540 Phobos Blue-shifted iC++ variant ...