Skip to main content

We narrowed to 63 results for: Gateway

Showing: 41 - 60 of 63 results
  1. Resolute Plasmid Collection

    Type
    Collection
    ...sequences for human SLCs and SLC binder sequences in Gateway-compatible cloning vectors (pDONR, pENTR), bacterial...Collection NeuroMab Plasmid Collection Addgene Blog: Gateway Cloning References Frommelt, F., Ladurner, R., ...
  2. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...pMH-Halo tag - Mammalian Gateway Destination Vector pENTR4-HaloTag (w876-1) - Gateway Entry Vector pCS2+/C-Halo...- Mammalian Expression pENTR4-SNAPf (w878-1) - Gateway Entry Vector pCS2+/C-SNAPf , pCS2+/N-SNAPf - Xenopus...- Mammalian Expression pENTR4-CLIPf (w877-2) - Gateway Entry Vector pET51b-His-TEV-CLIP-tag - Bacterial...Neveu Lab MXS Chaining Kit Lindquist Lab Yeast Gateway Kit Reading and Resources Addgene Blog: Which Fluorescent...
  3. Adenovirus Plasmids

    Type
    Collection
    ...Modified pShuttle-CMV (Addgene #16403) plasmid with Gateway cassette Zhang 50958 ShuttleNSE For production ...
  4. Synthetic Biology - Overview

    Type
    Collection
    ...Recombinant Phosphoprotein Kit S. cerevisiae Advanced Gateway Destination Vectors TAL Effectors Zinc Finger Consortium...
  5. Tetracycline Inducible Expression

    Type
    Collection
    ...Tet-On vector for inducible expression; insert with Gateway cloning and puromycin selection rtTA-Advanced Tight...promoter rtTA3 Wei Xu 26803 pEnt L1L3 EF1a-tTA-2 Gateway entry vector to express tTA from EF1α promoter,...
  6. Ras Pathway

    Type
    Collection
    ...vectors from the Esposito Lab for use with the Gateway® Cloning Platform (Life Technologies™) to permit...
  7. Molecular Cloning Techniques

    Type
    Guide
    ...completed via Gateway cloning. Addgene's collection contains thousands of Gateway donor , Gateway entry , and...backbone. Created with BioRender.com. Gateway Recombination Cloning Gateway cloning is a recombination-based...experimental goal. Although Gateway cloning is a simple and efficient cloning method, Gateway vectors and recombination...conditions. Read more in our Gateway Cloning blog post . Figure 2: Summary of Gateway cloning. Created with ...Molecular Cloning Techniques Restriction Enzyme Gateway TOPO Gibson Golden Gate & MoClo Ligation Independent...recombination-based cloning method. During Gateway, moving a piece of DNA from one plasmid into another is done via a single...fragment must first be amplified with specific Gateway attB1 and attB2 sites attached to the 5’ and 3’...
  8. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...
  9. Sequencing Primers

    Type
    Guide
    ...GCATGATGACCACCGATATG 3' end of Gateway cassette Forward GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette Reverse...
  10. Adenovirus Guide

    Type
    Guide
    ...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...
  11. Lentiviral Vector Guide

    Type
    Guide
    ...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...
  12. Modular Cloning Guide

    Type
    Guide
    ...inserts in one cloning step rather than two. Golden GATEway Cloning Kit Other, Zebrafish Expression Joachim...toolkit that combines Golden Gate and Multisite Gateway cloning. This system was specifically designed ...
  13. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...
Showing: 41 - 60 of 63 results