We narrowed to 64 results for: Gateway
-
TypeCollection...Hai-Ning Du Lab. A set of pCS2+ backbone-based Gateway destination vectors (pGCS), bearing either amino...HA, Flag, GST and eGFP epitopes. Zebrafish Tol2 Gateway-compatible Kit for Neurodegenerative Disorders ...
-
Cancer Research Plasmids and Resources
TypeCollection...vectors from the Esposito Lab for use with the Gateway® Cloning Platform (Life Technologies™) to permit... -
Botman-Teusink Yeast FP Collection
TypeCollection...Publication Additional Resources Kits MoClo-YTK Yeast Gateway Kit Multiplex Yeast Toolkit (MYT) Markerless Yeast... -
CRISPR References and Information
TypeCollection...; dCas9 activator gateway donors: pAC84 , pAC1 , pAC147 , pAC148 , pAC149 ; Gateway destination: pAC90... -
Synthetic Biology - Overview
TypeCollection...Recombinant Phosphoprotein Kit S. cerevisiae Advanced Gateway Destination Vectors TAL Effectors Zinc Finger Consortium... -
RNA Interference in Plant Biology: New Tools for an Old Favorite
TypeBlog Post... which allows easy creation of long hpRNA with Gateway-based cloning and straightforward positive selection... -
Adenovirus Plasmids
TypeCollection...pEZYshuttle Shuttle Modified pShuttle-CMV plasmid with Gateway cassette; See article for additional plasmids Zhang... -
How to Deposit Your Plasmids with Addgene
TypeBlog Post...For plasmids containing the ccdB gene, such as Gateway vectors, we recommend the ccdB Survival strain.... -
Special Delivery: Fluorophore Targeting for FRET Studies
TypeBlog Post...in intact cells. The Gradia Lab has deposited a gateway vector with Addgene, where you can insert your ... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...assembly. Gersbach MuLE System Mammalian MultiSite Gateway recombination-based cloning of complex polycistronic...plasmids available for use in this Golden Gate and Gateway based assembly method: plasmids for assembly of...a single T-DNA binary vector of choice through Gateway recombination. Qi Multiplex Conditional Mutagenesis... -
Antibody Validation for Flow Cytometry
TypeBlog Post...page. The data produced is available on the F1000 gateway and Zenodo community. Knockdown approach For... -
Fluorescent Protein Guide: FRET
TypeCollection...used with Clover pGWF1 Cyan & Yellow Bacterial Gateway-compatible vector to express a gene of interest... -
Ras Pathway
TypeCollection...vectors from the Esposito Lab for use with the Gateway® Cloning Platform (Life Technologies™) to permit... -
Cloning
TypeGuide...Back to Top Gateway® Recombination Cloning Gateway cloning (Image from Plasmid 101: Gateway Cloning ) Gateway... Gateway® cloning is a recombination based cloning method. The benefit of Gateway® is that moving a piece...cassettes). Although gateway cloning is a simple and efficient cloning method, gateway vectors and recombination...Guide Genome Engineering Guide Restriction Enzyme Gateway TOPO Gibson Type IIS Ligation Independent Cloning...fragment must first be amplified with specific Gateway attB1 and attB2 sites attached to the 5’ and 3’...sequence. This fragment can then be cloned into a gateway donor plasmid which contains compatible attP sites...it can be rapidly shuttled into any compatible Gateway® Destination vector, which contain attR sites via... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...specifically optimized for yeast Lindquist Lab Vectors - Gateway cloning; includes tagging with ECFP, EYFP, DsRed... -
Gamma-Retroviral Vector Guide
TypeGuide...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant... -
Sequencing Primers
TypeGuide...GCATGATGACCACCGATATG 3' end of Gateway cassette, forward primer GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette, reverse... -
Adenovirus Guide
TypeGuide...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant... -
Lentiviral Vector Guide
TypeGuide...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant... -
Adeno-associated virus (AAV) Guide
TypeGuide...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...