We narrowed to 60 results for: PSI-P

...Concepcion CP, Bonetti C, Vidigal JA, Han Y-C, Ogrodowski P, Crippa A, Rekhtman N, de Stanchina E, Lowe SW, Ventura...other vectors (Lukashev et al., 2016). The protein capsid encapsulating the genome is majorly composed of...Disease, Duchenne Muscular Dystrophy, Alpha1-antitrypsin deficiency (most widely used so far) or for cancer...

... F, Doerflinger N, Calléja C, Wendling O, Chambon P, and Ghyselinck NB. A directional strategy for monitoring...and Sternson SM. 2008. A FLEX switch targets Channelrhodopsin-2 to multiple cell types for imaging and long-range...

...1505. https://doi.org/10.1126/science.abd0826 Tong P, Gautam A, Windsor I, Travers M, Chen Y, Garcia N,...receptor for SARS-CoV. The lab also found that cathepsins play a role in SARS-CoV infection and deposited...deposited plasmids for the expression of cathepsin S, L, and B. This became a great starting point for SARS-CoV...

... 2304918. PubMed Central PMCID: PMC53514 Rowe, W. P., Hartley, J. W., Lander, M. R., Pugh, W. E., & Teich...transcriptase are packaged (Wu et al., 1997) inside of the capsid . This is useful for viral reproduction, and for...for reverse transcriptase (RT) is present in the capsid, as the engineered, recombinant genome is (thankfully...

... Therapy returns to centre stage. Nature Vol 526, p.351. PubMed PMID: 26469046. 6. The Forever Fix: Gene...choroideremia, X-linked retinitis pigmentosa, achromatopsia, and age-related macular degeneration are ongoing...further improve the technology: engineering of new capsid variants, designing expression cassettes to regulate...

...(is that pun worn out yet?) your research. Derek P. Simon received his PhD in Cellular and Molecular ...drsimonsaysscience.org or follow him on Twitter @derekpsimonphd.    References 1. Stuber, Garret D., et al....derived from direct comparative analysis of microbial opsins." Nature methods 9.2 (2012): 159-172.5. Goshen ...Addgene A Primer on Optogenetics: Introduction and Opsin Delivery The Materials Science of Optogenetics Experiments...

...PMID: 31082625. Ernst, Oliver P., et al. "Microbial and animal rhodopsins: structures, functions, and molecular...Microbial rhodopsins are encoded by opsin genes, and include bacteriorhodopsins, halorhodopsins, and channelrhodopsins...al., 2017). How to get an opsin into the brain In order to express opsins within the brain, researchers... a strong promoter upstream of an opsin gene (e.g., channelrhodopsin-2, ChR2) fused to a reporter gene...induces first opsin inversion, and then lox sites excision, therefore locking the opsin into the correct... 50 years ago with the discovery of microbial rhodopsins, light-sensitive proteins that absorb photons...light (Zhang et al., 2011). What do microbial rhodopsins and neurons have in common? Neuronal stimulations...

...Repurposing retrotransposons for DNA editing By Emily P. Bentley For RNA-guided genome editing, think beyond... systemic PHP.eB capsid, to express either the optogenetic activator channelrhodopsin-2 or fluorescent...

...Burger C, Gorbatyuk OS, Velardo MJ, Peden CS, Williams P, Zolotukhin S, Reier PJ, Mandel RJ, Muzyczka N (2004...short expression times, where as others, such as hSynapsin, are relatively weak and may require longer waiting...Recombinant AAV Viral Vectors Pseudotyped with Viral Capsids from Serotypes 1, 2, and 5 Display Differential...

...stem cell virus Reverse pBABE 5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors Forward...pBABE vectors Reverse pBABE 5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors Forward...vectors Forward Pry1 CTTAGCATGTCCGTGGGGTTTGAAT PZ P-element Reverse pTrcHis Forward GAGGTATATATTAATGTATCG...

...suitable for high throughput applications. Trepte P, et al. J. Mol. Biol. 2015. PubMed PMID: 26264872 ...Text. Seeliger MA, Young M, Henderso MN, Pellicena P, King DS, Falick AM, and Kuriyan J. Protein Sci. 2005... below:   ID Cv (Capsid) FLAG Tag Terminus 79629 (N) and 79628 (C) Cv (capsid) N and C 79633 (N...up to 120 kb) deletions in N. benthamiana and Arabidopsis. The authors found that deletion efficiency was...

...Furthermore, they find that during stress, mRNAs in P-bodies are translationally repressed whereas the nonsequestered... has developed rapid-response luciferase (firefly P. pyralis) reporter plasmids for use in high-throughput..., Adam Cohen's lab presented Archaerhodopsin 3 (Arch) as a new rhodopsin based voltage indicator for use...plasma membrane. To obtain a more sensitive channelrhodopsin actuator for triggering action potentials ...

...Blog Posts Read Our Primer on Optogenetics by Derek P. Simon Read Our Interview with Ed Boyden Resources...uses genetically encoded tools, such as microbial opsins, to control cellular activities using light. In...

...Hinrichs, C., Highfill, S. L., Somerville, R. P., Panch, S. R., Jin, P., & Stroncek, D. F. (2022). Genome-wide...Rev protein binds. Psi (Ѱ) in cis RNA packaging signal; recognized by nucleocapsid proteins and essential....2016.17 PMID: 27110581 Naldini, L., Blömer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F. H., Verma, I. M....Sabatini, D. M., Chen, I. S., Hahn, W. C., Sharp, P. A., Weinberg, R. A., & Novina, C. D. (2003). Lentivirus-delivered...12649500 Timms, R. T., Tchasovnikarova, I. A., & Lehner, P. J. (2018). Differential viral accessibility (DIVA...lentiviral particle containing matrix, capsid, and nucleocapsid components. pol in trans Precursor protein...major cellular determinant is LEDGF (also known as PSIP1 or p75 ), a lentiviral tethering gene that helps...

...through homologous recombination. Psi (Ψ) in cis Packaging or encapsidation signal located at the left arm...new window) Bulcha, J. T., Wang, Y., Ma, H., Tai, P. W. L., & Gao, G. (2021). Viral vector platforms within...Custers, J., Vellinga, J., Hendriks, J., Jahrling, P., Roederer, M., Goudsmit, J., Koup, R., & Sullivan...new window) Mendonça, S. A., Lorincz, R., Boucher, P., & Curiel, D. T. (2021). Adenoviral vector vaccine...in a new window) Rosewell, A., Vetrini, F., & Ng, P. (2011). Helper-dependent adenoviral vectors . Journal...viral particle and are only composed of a protein capsid and the viral genetic material inside. Adenoviral...structural proteins needed to assemble icosahedral capsids and build new virions. Figure 1: Wild-type adenovirus...

.... H. J., DiBerto, J. F., Giguere, P. M., Sassano, F. M., Huang, X. P., Zhu, H., Urban, D. J., White, K.../10.1117/1.NPh.11.2.021005 PMID: 38450294 Coward, P., Wada, H. G., Falk, M. S., Chan, S. D., Meng, F.,...15765260 Farrell, M. S., Pei, Y., Wan, Y., Yadav, P. N., Daigle, T. L., Urban, D. J., Lee, H. M., Sciaky...Sciaky, N., Simmons, A., Nonneman, R. J., Huang, X. P., Hufeisen, S. J., Guettier, J. M., Moy, S. S., Wess...Bonaventura, J., Lesniak, W., Mathews, W. B., Sysa-Shah, P., Rodriguez, L. A., Ellis, R. J., Richie, C. T., Harvey...j.isci.2025.112022. PMID: 40092615 Magnus, C. J., Lee, P. H., Atasoy, D., Su, H. H., Looger, L. L., & Sternson..., Y., Oyama, K., Ji, B., Takahashi, M., Huang, X. P., Slocum, S. T., DiBerto, J. F., Xiong, Y., Urushihata...

... M., Beyrière, F., Tsunoda, S. P., Mattis, J., Yizhar, O., Hegemann, P., & Deisseroth, K. (2008). Red-...Hegemann, P., Oertner, T. G., & Wiegert, J. S. (2015). An improved chloride-conducting channelrhodopsin for ...Fenno, L., Zhang, F., Hegemann, P., & Diesseroth, K. (2011). Microbial opsins: a family of single-component...Emiliani, V., Entcheva, E., Hedrich, R., Hegemann, P., Konrad, K. R., Lüscher, C., Mahn, M., Pan, Z. H....R., Ramakrishnan, C., Huguenard, J. R., Hegemann, P., & Deisseroth, K. (2011). Neocortical excitation/...Microbial Opsin Variants Opsin Type Variant Description Peak Response Spectra (nm) Channelrhodopsins: cation...our Biosensors Plasmid Collection . Microbial Opsins Opsins are light-gated ion channels or pumps that absorb...

...Velardo, M. J., Peden, C. S., Williams, P., Zolotukhin, S., Reier, P. J., Mandel, R. J., & Muzyczka, N. (...T., Inaba, T., Mizukami, H., Ozawa, K., & Colosi, P. (2004). The adenovirus E1A and E1B19K genes provide...Link opens in a new window) McCarty, D. M., Monahan, P. E., & Samulski, R. J. (2001). Self-complementary ...engineer new rAAV capsid variants, such as systemic capsids. A systemic capsid is a capsid that has been ... Engineered Variants Hybrid capsids Hybrid capsids are engineered capsids derived from multiple different...structural capsid proteins or viral proteins (VP1, VP2 and VP3) that form the icosahedral capsid of the virus...systemic AAV capsid could avoid invasive methods such as intracranial injection. Systemic capsids are often...

... 2 J2, TCRGJ2 TRGJP T cell receptor gamma joining P JP, TCRGJP TRGJP1 T cell receptor gamma joining P1... External Resouces Immport : Bhattacharya S, Dunn P, Thomas CG, Smith B, Schaefer H, Chen J, Hu Z, Zalocusky...1 CREB, MGC9284 CTSB cathepsin B APPS, CPSB CTSE cathepsin E CATE CTSL1 cathepsin L1 CATL, CTSL, FLJ31037...interleukin 1 family, member 6 (epsilon) FIL1, FIL1(EPSILON), FIL1E, IL-1F6, IL1(EPSILON), MGC129552, MGC129553...FLJ31037, MEP CTSS cathepsin S MGC3886 ERAP1 endoplasmic reticulum aminopeptidase 1 A-LAP, ALAP, APPILS, ...DHQ52, IGHD727 IGHE immunoglobulin heavy constant epsilon IgE IGHG1 immunoglobulin heavy constant gamma 1...

...tac ALS, motor neuron disease Trina Schroer 75437 p-AAV-sh[SNCA] SNCA U6 Parkinson's Edward Burton 75637... 12165 pSico Dnmt1 DNMT1 GFP CMV Hereditary sensory neuropathy type IE Tyler Jacks 12166 pSicoR Dnmt1 ...Rubinsztein 41846 psiCheck-ApoE3'UTR APOE SV40 Alzheimer's Sohail Tavazoie 41848 psiCheck-ApoECDS APOE Luc... Ho 102364 pSIN-PAmCherry-mSNCA-NE SNCA NE EF-1 alpha Parkinson's Shu Leong Ho 102366 pSIN-hSNCA-NE SNCA...Mathea 227004 pAAV-CMVenh synapsin-intron-aSYNUCLEIN A53T SNCA CMVenh synapsin Parkinson's Veerle Baekelandt...209085 piggyBac_rtTA (4th_Gen)_SNCA_IRES_NGN2-2A-PURO_Synapsin-BirA (pEHA1623) SNCA TRE Parkinson's Vikram ...piggyBac_rtTA (4th_Gen)_SNCA-Avi_IRES_NGN2-2A-PURO_Synapsin-BirA (pEHA1628) SNCA Avi TRE Parkinson's Vikram...