...transgene expression. Psi (Ψ) in cis RNA target site for packaging by Nucleocapsid. RRE in cis Rev Response...The transfer plasmid contains the viral LTRs and psi packaging signal (not pictured). Unless an internal... C, Guetard D, Nerhbass U, Montagnier L, Charneau P. Cell. 2000. 101(2): 173-185. PubMed . Woodchuck Hepatitis... a lentiviral vector. Naldini L, Blömer U, Gallay P, Ory D, Mulligan R, Gage FH, Verma IM, and Trono D...lentiviral particle containing Matrix, Capsid, and Nucleocapsid components. Pol in trans Precursor protein...for example, the U6 promoter is included in the pSico plasmid to drive shRNA expression. Other features...

...primer pBABE 5' CTTTATCCAGCCCTCAC (Weinberg Lab) Psi packaging signal, 5' of MCS in pBABE vectors, forward... in pRS vectors Pry1 CTTAGCATGTCCGTGGGGTTTGAAT PZ P-element, reverse primer pTrcHis Forward GAGGTATATATTAATGTATCG...

...Link opens in a new window) Chen X, Choo H, Huang X-P, Yang X, Stone O, Roth BL, Jin J (2015). The First...PMID: 25587888 (Link opens in a new window) Coward P, Wada HG, Falk MS, Chan SD, Meng F, et al. (1998)....Lee H-M, Sciaky N, Simmons A, Nonneman RJ, Huang X-P, Hufeisen SJ, Guettier J-M, Moy SS, Wess J, Caron ..., Bonaventura J, Lesniak W, Mathews WB, Sysa-Shah P, Rodriguez LA, Ellis RJ, Richie CT, Harvey BK, Dannals...Takuwa H, Hori Y, Oyama K, Ji B, Takahashi M, Huang X-P, Slocum ST, DiBerto JF, Xiong Y, Urushihata T, Hirabayashi...collection of PSAM plasmids ! LMOs Luminopsins (LMOs), or luminescent opsins, are opto-chemogenetic fusion ... enzyme generates light that activates the opsin. The opsin may excite or inhibit the neurons expressing...

... Hegemann P, Oertner TG, Wiegert JS. 2015. An improved chloride-conducting channelrhodopsin for light-... O, Fenno L, Zhang F, Hegemann P, Diesseroth K. 2011. Microbial opsins: a family of single-component tools...Beyrière F, Tsunoda SP, Mattis J, Yizhar O, Hegemann P, Deisseroth K. 2008. Red-shifted optogenetic excitation... Example: Jaws Browse Halorhodopsin plasmids . Archaerhodopsins Archaerhodopsin-3 (Arch) from Halorubrum...Microbial Opsin Variants Opsin Type Variant Description Peak Response Spectra (nm) Channelrhodopsins: cation...Optogenetics Plasmid Collection . Microbial Opsins Opsins are light-gated ion channels or pumps that absorb...trafficking signals to localize opsins to the cell membrane. Microbial opsins, such as those described below...

...Burger C, Gorbatyuk OS, Velardo MJ, Peden CS, Williams P, Zolotukhin S, Reier PJ, Mandel RJ, Muzyczka N. Mol...genes. The short coding sequences of channelrhodopsins, halorhodopsins, and other optogenetic genes enables...included the production of synthetic capsids and the mixing of capsids/ITRs from different AAV serotypes ...required for the AAV life cycle; VP1, VP2, VP3 - capsid proteins). When constructing an AAV transfer plasmid...of AAV through pseudotyping, or the mixing of a capsid and genome from different viral serotypes. These...containing the genome of serotype 2 packaged in the capsid from serotype 5. Use of these pseudotyped viruses... Scientists have also experimented with hybrid capsids derived from multiple different serotypes, which...