Skip to main content
Addgene

We narrowed to 6 results for: PSI-P

Showing: 1 - 6 of 6 results
  1. Sequencing Primers

    Type
    Guide
    ...primer pBABE 5' CTTTATCCAGCCCTCAC (Weinberg Lab) Psi packaging signal, 5' of MCS in pBABE vectors, forward... in pRS vectors Pry1 CTTAGCATGTCCGTGGGGTTTGAAT PZ P-element, reverse primer pTrcHis Forward GAGGTATATATTAATGTATCG...
  2. Lentiviral Vector Guide

    Type
    Guide
    ...Hinrichs, C., Highfill, S. L., Somerville, R. P., Panch, S. R., Jin, P., & Stroncek, D. F. (2022). Genome-wide...Rev protein binds. Psi (Ѱ) in cis RNA packaging signal; recognized by nucleocapsid proteins and essential....2016.17 PMID: 27110581 Naldini, L., Blömer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F. H., Verma, I. M....Sabatini, D. M., Chen, I. S., Hahn, W. C., Sharp, P. A., Weinberg, R. A., & Novina, C. D. (2003). Lentivirus-delivered...12649500 Timms, R. T., Tchasovnikarova, I. A., & Lehner, P. J. (2018). Differential viral accessibility (DIVA...lentiviral particle containing matrix, capsid, and nucleocapsid components. pol in trans Precursor protein...major cellular determinant is LEDGF (also known as PSIP1 or p75 ), a lentiviral tethering gene that helps...
  3. Adenovirus Guide

    Type
    Guide
    ...through homologous recombination. Psi (Ψ) in cis Packaging or encapsidation signal located at the left arm...new window) Bulcha, J. T., Wang, Y., Ma, H., Tai, P. W. L., & Gao, G. (2021). Viral vector platforms within...Custers, J., Vellinga, J., Hendriks, J., Jahrling, P., Roederer, M., Goudsmit, J., Koup, R., & Sullivan...new window) Mendonça, S. A., Lorincz, R., Boucher, P., & Curiel, D. T. (2021). Adenoviral vector vaccine...in a new window) Rosewell, A., Vetrini, F., & Ng, P. (2011). Helper-dependent adenoviral vectors . Journal...viral particle and are only composed of a protein capsid and the viral genetic material inside. Adenoviral...structural proteins needed to assemble icosahedral capsids and build new virions. Figure 1: Wild-type adenovirus...
  4. Chemogenetics Guide

    Type
    Guide
    ...Link opens in a new window) Chen X, Choo H, Huang X-P, Yang X, Stone O, Roth BL, Jin J (2015). The First...PMID: 25587888 (Link opens in a new window) Coward P, Wada HG, Falk MS, Chan SD, Meng F, et al. (1998)....Lee H-M, Sciaky N, Simmons A, Nonneman RJ, Huang X-P, Hufeisen SJ, Guettier J-M, Moy SS, Wess J, Caron ..., Bonaventura J, Lesniak W, Mathews WB, Sysa-Shah P, Rodriguez LA, Ellis RJ, Richie CT, Harvey BK, Dannals...Takuwa H, Hori Y, Oyama K, Ji B, Takahashi M, Huang X-P, Slocum ST, DiBerto JF, Xiong Y, Urushihata T, Hirabayashi...collection of PSAM plasmids ! LMOs Luminopsins (LMOs), or luminescent opsins, are opto-chemogenetic fusion ... enzyme generates light that activates the opsin. The opsin may excite or inhibit the neurons expressing...
  5. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...Velardo, M. J., Peden, C. S., Williams, P., Zolotukhin, S., Reier, P. J., Mandel, R. J., & Muzyczka, N. (...T., Inaba, T., Mizukami, H., Ozawa, K., & Colosi, P. (2004). The adenovirus E1A and E1B19K genes provide...Link opens in a new window) McCarty, D. M., Monahan, P. E., & Samulski, R. J. (2001). Self-complementary ...engineer new rAAV capsid variants, such as systemic capsids. A systemic capsid is a capsid that has been ... Engineered Variants Hybrid capsids Hybrid capsids are engineered capsids derived from multiple different...structural capsid proteins or viral proteins (VP1, VP2 and VP3) that form the icosahedral capsid of the virus...systemic AAV capsid could avoid invasive methods such as intracranial injection. Systemic capsids are often...
  6. Optogenetics Guide

    Type
    Guide
    ... Hegemann P, Oertner TG, Wiegert JS. 2015. An improved chloride-conducting channelrhodopsin for light-... O, Fenno L, Zhang F, Hegemann P, Diesseroth K. 2011. Microbial opsins: a family of single-component tools...Beyrière F, Tsunoda SP, Mattis J, Yizhar O, Hegemann P, Deisseroth K. 2008. Red-shifted optogenetic excitation... Example: Jaws Browse Halorhodopsin plasmids . Archaerhodopsins Archaerhodopsin-3 (Arch) from Halorubrum...Microbial Opsin Variants Opsin Type Variant Description Peak Response Spectra (nm) Channelrhodopsins: cation...Optogenetics Plasmid Collection . Microbial Opsins Opsins are light-gated ion channels or pumps that absorb...trafficking signals to localize opsins to the cell membrane. Microbial opsins, such as those described below...
Showing: 1 - 6 of 6 results