We narrowed to 6 results for: PSI-P

...stem cell virus Reverse pBABE 5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors Forward...pBABE vectors Reverse pBABE 5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors Forward...vectors Forward Pry1 CTTAGCATGTCCGTGGGGTTTGAAT PZ P-element Reverse pTrcHis Forward GAGGTATATATTAATGTATCG...

...Hinrichs, C., Highfill, S. L., Somerville, R. P., Panch, S. R., Jin, P., & Stroncek, D. F. (2022). Genome-wide...Rev protein binds. Psi (Ѱ) in cis RNA packaging signal; recognized by nucleocapsid proteins and essential....2016.17 PMID: 27110581 Naldini, L., Blömer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F. H., Verma, I. M....Sabatini, D. M., Chen, I. S., Hahn, W. C., Sharp, P. A., Weinberg, R. A., & Novina, C. D. (2003). Lentivirus-delivered...12649500 Timms, R. T., Tchasovnikarova, I. A., & Lehner, P. J. (2018). Differential viral accessibility (DIVA...lentiviral particle containing matrix, capsid, and nucleocapsid components. pol in trans Precursor protein...major cellular determinant is LEDGF (also known as PSIP1 or p75 ), a lentiviral tethering gene that helps...

...through homologous recombination. Psi (Ψ) in cis Packaging or encapsidation signal located at the left arm...new window) Bulcha, J. T., Wang, Y., Ma, H., Tai, P. W. L., & Gao, G. (2021). Viral vector platforms within...Custers, J., Vellinga, J., Hendriks, J., Jahrling, P., Roederer, M., Goudsmit, J., Koup, R., & Sullivan...new window) Mendonça, S. A., Lorincz, R., Boucher, P., & Curiel, D. T. (2021). Adenoviral vector vaccine...in a new window) Rosewell, A., Vetrini, F., & Ng, P. (2011). Helper-dependent adenoviral vectors . Journal...viral particle and are only composed of a protein capsid and the viral genetic material inside. Adenoviral...structural proteins needed to assemble icosahedral capsids and build new virions. Figure 1: Wild-type adenovirus...

.... H. J., DiBerto, J. F., Giguere, P. M., Sassano, F. M., Huang, X. P., Zhu, H., Urban, D. J., White, K.../10.1117/1.NPh.11.2.021005 PMID: 38450294 Coward, P., Wada, H. G., Falk, M. S., Chan, S. D., Meng, F.,...15765260 Farrell, M. S., Pei, Y., Wan, Y., Yadav, P. N., Daigle, T. L., Urban, D. J., Lee, H. M., Sciaky...Sciaky, N., Simmons, A., Nonneman, R. J., Huang, X. P., Hufeisen, S. J., Guettier, J. M., Moy, S. S., Wess...Bonaventura, J., Lesniak, W., Mathews, W. B., Sysa-Shah, P., Rodriguez, L. A., Ellis, R. J., Richie, C. T., Harvey...j.isci.2025.112022. PMID: 40092615 Magnus, C. J., Lee, P. H., Atasoy, D., Su, H. H., Looger, L. L., & Sternson..., Y., Oyama, K., Ji, B., Takahashi, M., Huang, X. P., Slocum, S. T., DiBerto, J. F., Xiong, Y., Urushihata...

... M., Beyrière, F., Tsunoda, S. P., Mattis, J., Yizhar, O., Hegemann, P., & Deisseroth, K. (2008). Red-...Hegemann, P., Oertner, T. G., & Wiegert, J. S. (2015). An improved chloride-conducting channelrhodopsin for ...Fenno, L., Zhang, F., Hegemann, P., & Diesseroth, K. (2011). Microbial opsins: a family of single-component...Emiliani, V., Entcheva, E., Hedrich, R., Hegemann, P., Konrad, K. R., Lüscher, C., Mahn, M., Pan, Z. H....R., Ramakrishnan, C., Huguenard, J. R., Hegemann, P., & Deisseroth, K. (2011). Neocortical excitation/...Microbial Opsin Variants Opsin Type Variant Description Peak Response Spectra (nm) Channelrhodopsins: cation...our Biosensors Plasmid Collection . Microbial Opsins Opsins are light-gated ion channels or pumps that absorb...

...Velardo, M. J., Peden, C. S., Williams, P., Zolotukhin, S., Reier, P. J., Mandel, R. J., & Muzyczka, N. (...T., Inaba, T., Mizukami, H., Ozawa, K., & Colosi, P. (2004). The adenovirus E1A and E1B19K genes provide...Link opens in a new window) McCarty, D. M., Monahan, P. E., & Samulski, R. J. (2001). Self-complementary ...engineer new rAAV capsid variants, such as systemic capsids. A systemic capsid is a capsid that has been ... Engineered Variants Hybrid capsids Hybrid capsids are engineered capsids derived from multiple different...structural capsid proteins or viral proteins (VP1, VP2 and VP3) that form the icosahedral capsid of the virus...systemic AAV capsid could avoid invasive methods such as intracranial injection. Systemic capsids are often...