Skip to main content

We narrowed to 754 results for: REV

Showing: 41 - 60 of 754 results
  1. Viral Vectors 101: Pseudotyping

    Type
    Blog Post
    ...development of pseudoviruses for enveloped viruses. Rev Med Virol 28:e1963 . https://doi.org/10.1002/rmv.1963...For more details, check out this review article published in Reviews in Medical Virology (Li et a., 2018...ultracentrifugation which helps scientists achieve a high titer (reviewed in Joglekar and Sandoval, 2017). This high titer...can be used for specific purposes as described previously (Table 1, Gutierrez-Guerrero, et al, 2020). Because...travel retrogradely, and jump the synapse to the previous neuron (Wichersham et al., 2007). However, once...specific to suit your needs. Check out some of these review articles to find tables and information on different...
  2. Viral Vectors 101: Integrase-Deficient Lentiviral Vectors

    Type
    Blog Post
    ...genome. The packaging plasmid contains Gag, Pol, Rev, and Tat genes. Specifically for our knowledge here...integration, and how researchers have modified them to prevent this integration.  Lentiviruses evolved to integrate... continue. They rely on a viral protein called reverse transcriptase to convert their RNA genomes into...viral genome is then part of the cellular DNA… forever!  This can be an advantage for researchers looking...integrase-deficient lentiviral vectors, let’s briefly revisit the basic biology of lentiviral vectors (for a ...processed from the larger protein: PR (protease), RT (reverse transcriptase), and IN (integrase). These viral... viral life cycle initially proceeds as usual. Reverse transcription of the transgene occurs in the cytoplasm...
  3. What is Polymerase Chain Reaction (PCR)

    Type
    Protocol
    ...PCR tubes. Put 50µl – 2.5µl (fwd primer) – 2.5µl (rev primer) = 45µl volume of master mix to add to each...primers for 30 seconds at 55°C: The forward and reverse primers are stable within this temperature range...nt) 2.5 μL Forward Primer (10 μM stock) 2.5 μL Reverse Primer (10 μM stock) 36.8 μL Sterile dH 2 O 0.2...nt) 2.5 μL Forward Primer (10 μM stock) 2.5 μL Reverse Primer (10 μM stock) 0.2 μL Taq DNA Polymerase ...DNA can be added to the master mix. Forward and Reverse Primers DO NOT get added to a master mix. Place...several times. Keep tube on ice. Add the forward and reverse primers to the thinned walled PCR tubes. Note: ... primer onto one side of the tube wall and the reverse primer onto the other. Add the master mix to the...
  4. CRISPR 101: Engineering the Plant Genome Using CRISPR/Cas9

    Type
    Blog Post
    ...–Cas in agriculture and plant biotechnology. Nat Rev Mol Cell Biol 21:661–677 . https://doi.org/10.1038...cytosine base editor or adenine base editor) and reverse transcriptase-mediated prime editing technologies...precise edits tend to be more efficient than HDR (reviewed in Zhu et al., 2019). Both cytosine base editors...Lew TTS, Sweeney CJ, Koman VB, Wong MH, Bohmert-Tatarev K, Snell KD, Seo JS, Chua N-H, Strano MS (2019)...
  5. RNA Interference in Plant Biology: New Tools for an Old Favorite

    Type
    Blog Post
    ...RNA Interference. Annu Rev Biophys 42:217–239 . https://doi.org/10.1146/annurev-biophys-083012-130404 ...downstream of DNA, such as RNA interference, can reversibly exert their effect independent of gene copy number...techniques It is fair to say that CRISPR has revolutionized molecular biology and has enabled functional...same gene. However, recent work has called this prevalent assumption into question. Specifically, CRISPR-generated...DNA template for the RNAi trigger is the most prevalent method due to ease of use and capacity to generate...RNA Interference System in Physcomitrella patens Reveals a Dominant Role of Augmin in Phragmoplast Microtubule...
  6. Plasmids 101: Using Transposons in the Lab

    Type
    Blog Post
    ...Eukaryotic Genomes. Annu Rev Genet 41:331–368. https://doi.org/10.1146/annurev.genet.40.110405.090448 Kumar...transcripts and then rely on a reverse transcriptase enzyme to reverse transcribe back into DNA before...another. This protein is either a transposase or a reverse transcriptase, depending on the mechanism of transposition...: gag and pol. The pol polyprotein encodes the reverse transcriptase and integrase enzymes which are required... with a poly(A). ORF2 encodes endonuclease and reverse transcriptase activities.    Figure 1: ...themselves as RNA transcripts and then use their reverse transcriptase (RT) enzyme to convert back into ...need to move around, either a transposase or a reverse transcriptase. Non-autonomous transposons, however...
  7. AAV Titration by qPCR Using SYBR Green Technology

    Type
    Protocol
    ... 2012 ) fwd ITR primer, 5'-GGAACCCCTAGTGATGGAGTT rev ITR primer, 5'-CGGCCTCAGTGAGCGA ITR-containing plasmid...water, then SYBR master mix, then the forward and reverse primers. Vortex briefly, immediately before use... μL 100 μM Forward Primer 0.15 μL 15 μL 100 μM Reverse Primer 0.15 μL 15 μL Nuclease Free Water 4.7 μL... made in step #1): Volume of 2 x 10 9 stock or previous dilution (μL) Volume of nuclease-free water (uL...
  8. Fluorescent Proteins 101: Photoactivatable Fluorescent Proteins

    Type
    Blog Post
    ... and mechanobiology: seeing is believing." Annu. Rev. Biomed. Eng. 10 (2008): 1-38. PubMed PMID:18647110... 570/ 596 Reversible photoactivation In contrast to irreversible PA-FPs, reversible PA-FPs (also known... into 2 main categories - those with irreversible and reversible photoactivation - and have enabled sophisticated...sophisticated imaging techniques.     Irreversible photoactivation Irreversible PA-FPs can be switched on from...another group of reversible PA-FPs. These were engineered to be the first reversible, monomeric red fluorescent...their fluorescence can be switched on and off reversibly. This ability to modulate fluorescence allows...takes less than a second. The first successful irreversible PA-FP reported was PA-GFP. PA-GFP was derived...
  9. Lentivirus ddPCR Titration

    Type
    Protocol
    ...primers and probes targeting integrated copies of the Rev response element (RRE) in the target cells but can...tgtgccttggaatgctagt probe (FAM): tttggaatcacacgacct reverse primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy...
  10. Genetic Code Expansion

    Type
    Collection
    ... of genetic code expansion in cell biology . Nat Rev Mol Cell Biol, 13 (3), 168–182. https://doi.org/10.1038...pAB228v TrpRS S. cerevisiae Bacterial Ahmed Badran 209745 pAB228v6 TrpRS S. cerevisiae Bacterial Ahmed ...things to consider. If you are working off of a previously established protocol, make sure to match the ..., ncAA concentration, and the cell lines used previously. Remember that the orthogonal pairs of aaRS and...209746 pAMC070n1a12 ScTrpRS, Lum1PylRS, MmPylRS S. cerevisiae, Lum1, M. mazei Bacterial Ahmed Badran 212122...window) Credits Contributing Authors Written and reviewed by the Scientific Curation team at Addgene. Media...opens in a new window) Last Updated Content last reviewed on 19 November 2025. Catalog items are updated...
  11. Lentiviral Vector Guide

    Type
    Guide
    ... containing reverse transcriptase and integrase components. rev in trans Binds to the Rev Response Element... , pol , tat , and rev Two plasmids, one encoding gag/pol and another encoding rev Envelope Plasmid Interchangeable...nuclear export. RRE in cis Rev Response Element; the sequence to which the Rev protein binds. Psi (Ѱ) in...additionally require the regulatory genes tat and rev , along with virus-specific accessory genes (for ...genes gag and pol , and regulatory genes tat and rev ; separated into two plasmids in third generation...Packaging plasmid — contains gag , pol , tat , and rev Envelope plasmid — contains env All second-generation...contains gag and pol Packaging plasmid 2 — contains rev Envelope plasmid — contains env Third-generation ...
  12. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ... replication. 5’LTR 5’ long terminal repeat. RRE Rev response element. A.3 Related Products The following... RNA polymerase III. Note that these were the prevailing guidelines when the pLKO.1 vector was created...CCGG—21bp sense—CTCGAG—21bp antisense—TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA—21bp sense—CTCGAG...AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA AATGCCTACGTTAAGCTATAC...the sticky ends of EcoRI and AgeI. Forward and reverse oligos are annealed and ligated into the pLKO.1...concentration of 20 μM, then mix: 5 μL Forward oligo 5 μL Reverse oligo 5 μL 10x NEB buffer 2 35 μL ddH 2 O Incubate...TRC Cloning Vector The following steps were the prevailing guidelines when the pLKO.1 vector was created...
  13. Sequencing Primers

    Type
    Guide
    ...cell virus Forward MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus Reverse MT1-F GCTGTCCTCTAAGCGTCACC...tdTomato Forward tdTomato-Rev TCTTTGATGACGGCCATGT 5' end of tdTomato Reverse Tet-R GGCGAGTTTACGGGTTGTTA...' end of DsRed1 Reverse EBV Reverse GTGGTTTGTCCAAACTCATC SV40 polyA terminator Reverse Ecdysone Forward... pGP704 vector Reverse pHybLex Reverse GAGTCACTTTAAAATTTGTATACAC ADH terminator Reverse pLTet-F ACTGAGCACATCAGCAGGAC...TGTAAAACGACGGCCAGT In lacZ gene Forward M13 Reverse CAGGAAACAGCTATGAC In lacZ gene Reverse M13/pUC Forward CCCAGTCACGACGTTGTAAAACG...lacZ gene Foward M13/pUC Reverse AGCGGATAACAATTTCACACAGG In lacZ gene Reverse MSCV Forward CCCTTGAACCTCCTCGTTCGACC...virus Forward MSCV Reverse CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus Reverse pBABE 5' CTTTATCCAGCCCTCAC...
  14. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Written and reviewed by the Scientific Curation team at Addgene. Last Updated Content last reviewed on 4 December...Khakh ATP FRET-based ATP sensor ATeam1.03-nD/nA Reversible dimerization of Aequorea victoria fluorescent...patterning of cGMP in vascular smooth muscle cells revealed by single GFP-linked biosensors. Proc Natl Acad...Peredox-mCherry in plants In Vivo NADH/NAD+ Biosensing Reveals the Dynamics of Cytosolic Redox Metabolism in Plants...in plants A family of NADPH/NADP(+) biosensors reveals in vivo dynamics of central redox metabolism across...for pyruvate A highly responsive pyruvate sensor reveals pathway-regulatory role of the mitochondrial pyruvate...pHluorin Two pathways of synaptic vesicle retrieval revealed by single-vesicle imaging. Neuron. 2009 Feb 12...
  15. Brain Initiative Collection

    Type
    Collection
    ...pAAV-EF1a-iCreV can be used to generate AAV virus that will express light-inducible site-specific iCreV recombinase...pAAV-EF1a-iDreV can be used to generate AAV virus that will expresslight-inducible site-specific iDreV recombinase...Neurotechnologies® (BRAIN) Initiative aims to revolutionize our knowledge of the human brain through the... behavior. Long desired by researchers, the revolutionary dynamic picture of the brain generated through...will provide novel ways to treat, cure, and even prevent brain disorders. The BRAIN Initiative supports ...
  16. Open Enzyme Collection

    Type
    Collection
    ...Ligases DNA Polymerases Restriction Endonucleases Reverse Transcriptases RNA Polymerases Other Enzymes Additional...DNA polymerases, RNA polymerases, DNA ligases, reverse transcriptases, and restriction enzymes. These ...reaction (PCR), cloning, isothermal amplification, reverse transcription of RNA into DNA, and dNTP synthesis...Ligases DNA Polymerases Restriction Endonucleases Reverse Transcriptases RNA Polymerases Other Enzymes DNA...pOpen-XbaIR XbaI 165568 pOpen-NcoIR NcoI Return to top Reverse Transcriptases Addgene ID Plasmid Gene/insert 165546...pOpen-MMLV_RT (mut H) Moloney Murine Leukemia Virus (MMLV) Reverse Transcriptase (RNAse H deactivated by 3 mutations... (lack H) Moloney Murine Leukemia Virus (MMLV) Reverse Transcriptase RNaseH - (lacking RNaseH domain) ...
  17. CRISPR Guide

    Type
    Collection
    ...the donor template, incorporating mutations that prevent further Cas9 cleavage will improve the accuracy... method in which Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) is fused to the C-terminus...the desired edit is incorporated into the DNA by reverse transcription. The edited DNA strand displaces ...editing. PASTE uses a CRISPR-Cas9n fused to both a reverse-transcriptase and a serine integrase (Bxb1), along...dCas9-mediated gene activation or repression is reversible, as it does not permanently modify the genomic...multiple fusions. The effects of CRISPRi/a may be reversible once the effector is inactivated or removed from... and even cell differentiation. The system is reversible, with a companion CRISPRon to undo repression...
  18. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...search and replace” gene editing method in which a reverse transcriptase (RT) is fused to the C terminus of...the desired edit is incorporated into the DNA by reverse transcription. The edited DNA strand displaces ... use the Moloney murine leukemia virus (M-MLV) reverse transcriptase. Engineering of the PE enzyme and...editing, including exploring new sources for the reverse transcriptase. Many PE enzymes and related tools...additional protection added to 3’ tail of pegRNA to prevent RNA degradation For more in-depth information on...Design Tools CRISPR Blogs CasPEDIA Content last reviewed: 17 October 2025 Do you have suggestions for other...
Showing: 41 - 60 of 754 results