...Addgene's Datatable of validated gRNA sequences....validated for use in CRISPR experiments. This datatable is compiled from plasmids in Addgene's database...designed to accomplish. Validated gRNA Sequence Datatable Target Gene Target Species Target Sequence Plasmid...pyogenes 25739462 Jiang ade6-L469 S. pombe TCTATTGTTCAGATGCCTTG 52227 cut S. pyogenes 25352017 Zaratiegui...Zaratiegui ade6-M210 S. pombe TCTATTGTTCAGATGCTTCG 52226 cut S. pyogenes 25352017 Zaratiegui ade6+ S. pombe TCTATTGTTCAGATGCCTCG... TCTATTGTTCAGATGCCTCG 52225 cut S. pyogenes 25352017 Zaratiegui Alk and Eml M. musculus 64071 cut S. pyogenes...25337876 Ventura Amplicon, JAK2 H. sapiens GAGGCATATTCTTCTCCTGG 70660 cut S. pyogenes 26472758 Sabatini ...

...caused from loss-of-function mutations in the MECP2 gene. Causative mutations for Rett syndrome typically...within patients with the same mutation, the location and type of MECP2 mutation can be a strong predictor ...missense mutations located in the MBD, and truncations prior to the NID are more severe than mutations further...to their laboratory website. Cell Line Mutation (DNA) Mutation (protein) Sex Source of Material Publication...species (mouse or human) Mutation ID Plasmid Description Gene/Insert Mutations PI Return to top External...meet diagnostic criteria have disease-causing mutations in the gene methyl-CpG binding protein 2 ( MECP2...erminal D omain (CTD) The most common missense mutations cluster in the MBD and NID demonstrating the importance...

...autoclave, you should prepare your plate pouring station: Find an empty section of lab bench with a working...thermometer. Light the flame at the plate pouring station and dilute your antibiotic into your ~60 ℃ molten...

...Barros Lactate/Pyruvate Lapronic FRET-based sensor for Lactate/Pyruvate Ratio Imaging of the Lactate/Pyruvate...(4):525-531.e4. Dmytro Yushchenko Lactate Laconic FRET-based lactate sensor Barros Lab Laconic Plasmids...Felipe Barros Lactate Expresses eLACCO1.1 fluorescent biosensor for extracellular L-lactate, in neurons,...extracellular L-lactate. Nat Commun. 2021 Dec 6;12(1):7058. Marie-Eve Paquet , Robert Campbell Lactate Lindoblum... fluorescent biosensor for lactate Green fluorescent protein-based lactate and pyruvate indicators suitable... cytosolic NADH/NAD+ redox state Imaging Cytosolic NADH-NAD(+) Redox State with a Genetically Encoded ...Oct 23;9(10):e110600. Isei Tanida Electrostatic potential Quantitative measurements of membrane charges...

...recombinase-dependent: Excitatory Opsins Addgene ID Plasmid Logic Sites and Mutations 55645 pAAV-hSyn Con...Collection INTRSECT Plasmid Collection INTRSECT Implementation Plasmids References The development of powerful...producing a functional molecular tool (C,F). Implementation The following resources may be of interest ...developed, including additional fluorophores, excitatory and inhibitory opsins , genetically-encoded calcium...Recombinases Addgene ID Plasmid Logic Sites and Mutations 55636 pAAV-EF1a-Cre None 55632 pAAV-Ef1a-mCherry-IRES-Cre...-dependent Addgene ID Plasmid Logic Sites and Mutations 55641 pAAV-Ef1a-fDIO EYFP Flp 55640 pAAV-Ef1a-...Fluorophores Addgene ID Plasmid Logic Sites and Mutations 55650 pAAV-hSyn Con/Fon EYFP Cre AND Flp 231926...

...span the knock-in gene. For making mutations, one good way is to mutate the PAM 'NGG' sequence in the HR...a silent mutation. When attempting to use the CRISPR/Cas9 system to create specific mutations or insertions...possible. For introducing small mutations (<50bp) or a single-point mutation, the best HR template for transfection...the introduction of a mutation into the genome, how can cells with that mutation be selected/screened?...on each side flanking your desired insertion or mutation. Each arms is around 800bp. For transfection in...the HR template, you usually would need to make mutations of the HR template to avoid this donor plasmid...being degraded by Cas9 in cells. One good way is to mutate the PAM 'NGG' in the HR template, like change it...

...developed by mutating specific amino acid residues to reduce off-target editing. Some mutations disrupt interactions...off-target mutations in DNA, RNA, or both, and are recommended in contexts where such mutations would be...target DNA. Once the Cas9-gRNA complex binds a putative DNA target, the seed sequence (8–10 bases at the... and a gRNA will result in a diverse array of mutations (see: Validate genetic modification ). In most...amino acid deletions, insertions, or frameshift mutations leading to premature stop codons within the open...targeted gene. The ideal result is a loss-of-function mutation within the targeted gene. However, the strength...Catalytically inactive “dead” Cas9 (dCas9) contains mutations in both nuclease domains, D10A and H840A, resulting...

...contain the A206K mutation are monomeric at all concentrations, so this is mutation is noted when present....g. off to on) Excitation and Emission wavelengths after activation. Protein Excitation (nm) Emission ... Fusions (Organized by Color) For each table: Excitation and Emission maximum are listed in nm. Brightness...Structure describes the monomeric or oligomeric state of the protein. Many FPs are monomers at low concentration...Photoconvertible Photoswitchable Timers Blue/UV Protein Excitation (nm) Emission (nm) Brightness pKa Maturation ...Bacterial Expression Jump to Top Cyan Protein Excitation (nm) Emission (nm) Brightness pKa Maturation ...Bacterial Expression Jump to Top Green Protein Excitation (nm) Emission (nm) Brightness pKa Maturation ...

...for 3 h without stirring to allow full precipitation. Precipitation of the viruses can proceed overnight...

...Furthermore, in cells containing two mutated alleles, each mutated allele may be different owing to the...Provides a semi-quantitative readout of the percentage of alleles that have been mutated within a mixed... type or organism without a specific preferred mutation Cas9 (or Cas9 nickase) Single (or dual) gRNA targeting...increases specificity but is less efficient. Each putative knockout allele must be experimentally verified... a particular gene, such as generating a point mutation or inserting a tag Cas9 (or Cas9 nickase); Base...knockout. Base editors can make a limited set of mutations. Repress or Interfere (CRISPRi) Reduce expression... the N-terminus are targeted since frameshift mutations here increase the likelihood that a nonfunctional...

...71. PMID: 19066593 Other citations include: Bogner, et al. 2015. Capsid Mutated Adeno-Associated Virus ...References for each serotype can be found below under Citations. AAV2(Y444F) The AAV2(Y444F) serotype is demonstrated...from the AAV2 capsid and contains the following mutations: Y444F, Y500F, and Y730F. AAV2(4pMut)dHS The AAV2...It is derived from AAV2 and has the following mutations: Y444F, Y500F, Y730F, T491V, R487G, R585S, and...from the AAV6 capsid and contains the following mutations: Y705F, Y731F and T492V. AAV44.9 The AAV44.9 serotype...Beta actin (CBA) GFP Control Sergei Zolotukhin Citation Information AAV2(Y444F) When using the AAV2(Y444F...Ther . Feb;19(2):293-301. PMID: 21045809 Other citations include: Chen, et al. 2014. Reprogramming adipose...

...frequently mutated gene (>50%) in human cancer; most of these mutations are missense mutations in the DNA-binding...regulator; also known as MDM4 Noxa Phorbol-12-myristate-13-acetate-induced protein 1; also known as PMAIP1 ...19776742 . Germline TP53 mutations and Li-Fraumeni syndrome. Varley JM. Hum Mutat. 2003 Mar;21(3):313-20..., often at one of six hotspot residues. These mutations can be inherited or arise through exposure to ... (e.g., HPV, the human papillomavirus). These mutations interfere with p53’s ability to activate transcription...Li-Fraumeni syndrome. Recently some impacts of p53 mutations have been characterized as gain-of-function, expanding...;415(6867):45-53. PubMed PMID: 11780111 . p53 mutations in human cancers. Hollstein M, Sidransky D, Vogelstein...

...protein complexes. Includes: Immunoprecipitation (IP) Chromatin immunoprecipitation (ChIP) Visualization - ...Capture methods such as immunoprecipitation (IP) and chromatin immunoprecipitation (ChIP) allow you to isolate...which emit a specific wavelength of light after excitation by light of a specific wavelength. While more...interactions in a specific timeframe or context. Immunoprecipitation (IP) IP uses immobilized antibodies to isolate... on the same general strategy. Figure 5: Immunoprecipitation using bead-based antibody capture to isolate...isolating protein from serums. Chromatin immunoprecipitation (ChIP) This variation of IP uses antibodies...for individual assays. Clear cell debris by sedimentation. Proceed with IP using a primary antibody for...

...method for the systematic and quantitative analysis of co-immunoprecipitations using both Renilla and Firefly...luminescence-based co-immunoprecipitation to assess protein-protein interactions. NanoLuc® complementation : Protein-protein...enhancers and untranslated regions, or the effect of mutations of these regulatory elements on gene expression...a convenient toolkit to assess the proteostasis status in a wide range of experimental systems. LumiLuc... DULIP ( DU al L uminescence-based C o- I mmunoprecipitation) plasmids : Luminescence-based protein-protein...more. nLuc/cLuc for split Firefly Luciferase complementation in plants. Bioluminescence Resonance Energy...Firefly Insertion of 5' promoter/enhancer regions. Mutations within the luciferase gene allow for increased...

...promoter forward primer: CGTAACTTGAAAGTATTTCGATTTCTTGGC. This is a representative sequencing primer; other...2001. PubMed . MicroRNA detection in prostate tumors by quantitative real-time PCR (qPCR). Gordanpour...the full-text of the publication here . Article Citation Generation of Genomic Deletions in Mammalian Cell...alleles 2 , which are likely to cause frameshift mutations leading to nonsense mediated decay of the mRNA...2A ). However, DSB will occur independent of orientation of the protospacer sequence/PAM relative to the...samples on 2% agarose gel at 10 V/cm using 1x Tris-acetate-EDTA (TAE) buffer. Examine samples for the presence... per well for a final volume of 150 μl. This facilitates screening by allowing a multichannel pipette ...

...technologies consist of insertional chromatin immunoprecipitation (iChIP) and engineered DNA-binding molecule-mediated...molecule-mediated chromatin immunoprecipitation (enChIP; Fujita & Fujii, 2013). In iChIP, specific genomic... proteins of EPAS1 identified by enChIP-MS - A putative role of HDX as a negative regulator. Hamidian ... DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) using CRISPR. Fujita T, Fujii H.... DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP). Fujita T, Asano Y, Ohtsuka J, Takada...insulator components by insertional chromatin immunoprecipitation. Fujita T, Fujii H. PLoS One. 2011;6(10):....0026109. PubMed . Insertional chromatin immunoprecipitation: a method for isolating specific genomic ...

...correcting a typo in the latest draft of your dissertation. Well, that will probably never happen. Yet ... to this DNA targeting ideal. Figure 1: (A) Representation of a zinc finger (ZF) nuclease. Zinc fingers...for molecular tools. ZFs are not without their limitations, however. Not every nucleotide triplet has a ...Martin-Luther-University Halle-Wittenberg and Adam Bogdanove at Iowa State University published the nucleotide recognition ...if not slightly lower. Figure 2: Simplified representation of the Voytas/Bogdanove Golden Gate TALEN kit...in a C. elegans lab and have been struggling to mutate a specific gene or your anxiously investigating...

...TALEN Guide. These collections and accompanying documentation allow one to efficiently assemble TALEN constructs...truncated at both the N and C terminus and induces mutation at rates much higher than the parental vectors...generation architecture has been shown to increase mutation induction when using TALENs. The FokI domains ...homodimeric or enhanced heterodimeric (ELD, KKR mutations) FokI domains. 40131 pCAG-T7-TALEN(Sangamo)-FokI-KKR-Destination...are designed to target and edit the epigenome of putative enhancers in mammalian cells. These plasmids allow...suitable for the TALEN-based generation of germline mutations in Bombyx mori and Drosophila melanogaster . Zhang...

...MGC110940, OPN SST somatostatin SMST SSTR1 somatostatin receptor 1 SRIF-2 SSTR2 somatostatin receptor 2 - SSTR5...arginine-rich, mutated in early stage tumors ARP, MANF, MGC142148, MGC142150 ARMETL1 arginine-rich, mutated in early...GHRFR, GHRHRpsv, GRFR GHRL ghrelin/obestatin prepropeptide MTLRP, obestatin GHSR growth hormone secretagogue...growth inhibitor 1 BDGI, OKL38 OSM oncostatin M MGC20461 OSMR oncostatin M receptor MGC150626, MGC150627,...have plasmids available for request. Antigen Presentation The cornerstone of the immune response is the...including dendritic cells and macrophages. Antigen presentation is mediated by the MHC class I and class II ...available for request. Antigen Processing and Presentation The cornerstone of the immune response is the...

...host organism. Host Relevant Promoters Representative Empty Backbones Mammalian CMV, SV40, EF1a, ...could allow you to conduct western blots or immunoprecipitations of your favorite gene even if you do...Tag or Fusion Protein Common uses Representative Empty Backbones Flag Epitope tag... Marker Typical Host Organism Representative Empty Backbones Neomycin (G418) ...methods: Delivery method Advantages Representative Empty Backbones Lentiviral Can transduce...and genome modification Element Details Representative Empty Backbones Promoter Measure...