We narrowed to 58 results for: ef1
-
TypeCollection...axon terminals. 1 Luo 60658 pAAV-EF1α-F-FLEX-mNaChBac-T2A-tdTomato EF1a-driven, Flp-dependent Flp-dependent...System Activity Serotype PI 98747 pAAV-FLEX-EGFPL10a EF1a-driven and Cre-dependent EGFP-tagged ribosomal L10a...ablation. 2 Jessell , Azim 45580 pAAV-flex-taCasp3-TEVp EF1a-driven, Cre-dependent Cre-dependent, bicistronic...atherosclerosis. 8 Bentzon 176267 pAAV-FLEX-P301L Tau EF1a-driven, Cre-dependent Cre-dependent expression of...
-
Genetic Code Expansion
TypeCollection...4xMmaPylT(UCA)_EF1_MmaPylRS PylRS M. mazei Mammalian TGA Simon Elsaesser 174901 pAS_MmaPylT_EF1_NES-MmaPylRS...pCNP) Bacterial TAG Thomas Huber 174890 pAS_8xMmaPylT_EF1_FLAG-MmaPylRS PylRS M. mazei Mammalian TAG Simon... Simon Elsaesser 174896 pAS_4xMmaPylT(UUA)_EF1_MmaPylRS PylRS M. mazei Mammalian TAA Simon Elsaesser 174899...mazei Mammalian TAG Simon Elsaesser 174902 pAS_MmaPylT_EF1_NES-MmaPylRS AF PylRS (Y306A, Y384F) M. mazei...E. coli Bacterial TAG Abhishek Chatterjee 220800 EF1a-L274GMmMetRS-T2A-mCherry MetRS M. musculus azidonorleucine... -
Structural Genomics Consortium Plasmids
TypeCollection...vector 26117 pNIC-CH EF199843 Hexahistidine tag, AmpR 26103 pNIC28-Bsa4 EF198106 Hexahistidine tag with...with TEV cleavage, KanR 26105 pNIC-CTHF EF199844 Hexahistidine tag, FLAG tag with TEV cleavage, KanR 26106... Z-basic, TEV cleavage, AmpR 26108 pFB-LIC-Bse EF199842 Hexahistidine tag with TEV cleavage, AmpR 26095... -
Tetracycline Inducible Expression
TypeCollection...Wei Xu 26803 pEnt L1L3 EF1a-tTA-2 Gateway entry vector to express tTA from EF1α promoter, for Tet-Off....transactivator Tet-On 3G rtTA Elena Cattaneo 104543 PB-EF1a-TetOn3G PiggyBac vector expressing Tet-On 3G transactivator...transactivator constitutively expressed by EF1a promoter Tet-On 3G rtTA David Vereide 120309 pAAV-FAH-rtTA3G.... Adam Karpf 167935 pLenti-tetON-KRAB-dCas9-DHFR-EF1a-TagRFP-2A-tet3G Tet-inducible expression of KRAB-dCas9... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...Representative Empty Backbones Mammalian CMV, SV40, EF1a, CAG, Ubc Transient expression - Gradia Lab plasmids...Resources collection page Zebrafish CMV, h2afv, XlEef1a1 See our dedicated Zebrafish Plasmids and Resources...backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-zeo resistance marker pLenti CMV/TO GFP-Zeo DEST... -
Botman-Teusink Yeast FP Collection
TypeCollection...p415 plasmid (Loqué et al., 2007) containing the TEF1 promoter and the LEU2 marker, or the pCEV-G2-Km ...Km plasmid (Vickers et al., 2013) containing the TEF1 or PGK1 promoters and the KanMX marker. ID Plasmid... -
Viral Production
TypeCollection...: AAV Pro cells were transduced with either pAAV-Ef1a-mCherry-IRES-Cre (55634-AAVrg) alone at 1.7E6 viral...Cre. mCherry expression alone was detected. pAAV-Ef1a-mCherry-IRES-Cre was a gift from Karl Deisseroth... -
TALEN Plasmids and Kits
TypeCollection...galactose-inducible expression. pTAL6-BB contains the TEF1 promoter, giving constitutive expression of TALORs...gene expression. The vectors listed below have the EF1α promoter for efficient mammalian cell expression... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Mammalian Gibson none S. pyogenes Zack pHL-H1-ccdB-mEF1a-RiH 60601 Mammalian BamHI/EcoRI none S. pyogenes...Lentiviral BsmBI yes, cut S. pyogenes Jacks pU6-sgRNA EF1Alpha-puro-T2A-BFP 60955 Mammalian/Lentiviral none S... -
Brzezinski Lab CRISPR Collection
TypeCollection...modifications: replacement of the Cbh promoter with EF1alpha addition of an mCherry reporter variant nuclear... -
Lentiviral Prep Service
TypeCollection...encoding dCAS9-VP64 with 2A Blast resistance marker (EF1a-NLS-dCas9(N863)-VP64-2A-Blast-WPRE) Zhang Pooled... -
Arf GTPase Family
TypeCollection...Bacterial (pGEX4T), Mammalian (pEGFP-N3), Gateway GEF Arfgef1 (BIG1, ARFGEP1) 10565 1849 Mammalian (pcDNA4c, ... -
Ras Pathway
TypeCollection...guanine nucleotide dissociation stimulator RAPGEF RAPGEF1 RAPGEF2 Rap guanine nucleotide exchange factor ... -
Immunology Research Plasmids and Resources
TypeCollection...Dfy, FY, GPD, GpFy, WBCQ1 DEFA1 defensin, alpha 1 DEF1, DEFA2, HNP-1, HP-1, MGC138393, MRS DEFA3 defensin...phosphoribosyltransferase 1110035O14Rik, DKFZp666B131, MGC117256, PBEF, PBEF1, VF, VISFATIN NDP Norrie disease (pseudoglioma) ... -
Zhang Lab CRISPR Page
TypeCollection...backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-zeo resistance marker. Contains BsmBI sites for ... -
Promoters
TypeGuide...Strong mammalian promoter from human cytomegalovirus EF1a Constituitve Strong mammalian promoter from human... -
Chemogenetics Guide
TypeGuide...Neurons GFAP Glia CD68 Microglia Dlx Interneurons EF1a, CAG General expression Targeted expression. Depending... -
Validated gRNA Sequences
TypeCollection...TTGATATTTAAGTTAATAAA 62320 scaffold S. pyogenes 25533786 Qi & Lim TEF1 S. cerevisiae TTGATATTTAAGTTAATAAA 46922 interfere...