Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 938 results for: mpl

Showing: 41 - 60 of 938 results

  1. Antibody Plasmid Collection

    Type
    Collection
    ...microscope, or detect when the protein is present in a sample — just to name a few. Traditional sources of antibodies...individual clone targeting a single antigen. An example of R-mAbs is the NeuroMab collection — monoclonal...single-domain antibodies (also known as nanobodies). For example, scientists often use plasmids encoding scFv fragments...recombinant antibody fragments in the form of scFvs A simple vector system to improve performance and utilisation...

  2. Distribution to Industry

    Type
    Collection
    ...Insert PI Kits Kit name Type PI Description High Complexity Golden Gate Assembly Standards Kit Cloning Eric...allowed to use for distribution. Please see the Sample Agreements on our Technology Transfer Information...Scientist Acknowledgement (RSA). This form can be completed electronically by the scientist who will be using...using the materials in the order. After the RSA is complete, Addgene will send you a copy of the MTA, which...

  3. Promega Plasmid Collection

    Type
    Collection
    ...help advance science while reducing operational complexity. This unique collection contains plasmids developed... below to find plasmids in the collection. For example, search by response element, reporter, protein,...Link opens in a new window) is a structural complementation reporter system composed of a Large BiT (LgBiT...LgBiT; 18 kDa) subunit and a small complementary peptide, Small BiT (SmBiT; 11 amino acids). This system...

  4. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed...Nickase mutants can also be used with a repair template to introduce specific edits via homology-directed...primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert Promoter PI Publication...

  5. TALEN Guide

    Type
    Collection
    ...Figure 2: Simplified representation of the Voytas/Bogdanove Golden Gate TALEN kit. In this example, the final...bind adenenine with lower specificity). With the template for studying this type of technology already laid... bp. TAL effectors have some restrictions (for example, the target must start with a T), but they still...

  6. Arf GTPase Family

    Type
    Collection
    ...ARF GTPase family, information on each gene, and examples of plasmid types available for each gene. Click...request. Family Gene Entrez Gene ID Length (aa) Example Expression Systems GTPase Arf1 375 181 Bacterial... and GEF family, information on each gene, and examples of plasmid types available for each gene. Click...request. Family Gene Entrez Gene ID Length (aa) Example Expression Systems GAP Arfgap1 (ARF1GAP) 55738 ...

  7. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ... Expression mPlum 590 649 4 4.5 100 min Monomer pQC mPlum IX - Mammalian Expression mPlum-N1 - Mammalian...Mammalian Expression mPlum-C1 - Mammalian Expression mPlum-pBAD - Bacterial Expression mRaspberry 598 625 13...

  8. CRISPR Plasmids for Genomic Visualization

    Type
    Collection
    ...techniques, including that it is easy to implement due to the simplicity of gRNA design, programmable for different...copies of labeled proteins to the given region. For example, chromosome-specific repetitive loci can be efficiently...

  9. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ...Cascade ( C RISPR- as sociated c omplex for a ntiviral de fense) complex, comprised of a combination of ...difficulties in getting all components of the Cascade complex to express equally. To combat this, some CRISPR-Cas3...

  10. CRISPR Plasmids - Yeast

    Type
    Collection
    ...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed...Nickase mutants can also be used with a repair template to introduce specific edits via homology-directed...

  11. Worm Expression Resources

    Type
    Collection
    ...below and not included in this table. For a more complete list of plasmids that can be used in worms, search...backbones, and constructs for endogenous tagging. Some examples of useful worm CRISPR resources, along with links...set of plasmids for building homologous repair templates that incorporate a self-excising drug selection...

  12. Validated gRNA Sequences

    Type
    Collection
    ...the Cas9 application the gRNA was designed to accomplish. Validated gRNA Sequence Datatable Target Gene...musculus 64071 cut S. pyogenes 25337876 Ventura Amplicon, JAK2 H. sapiens GAGGCATATTCTTCTCCTGG 70660 cut...GCGCTTACACTTTAGGAGACACTC 61080 purify S. pyogenes 25051498 Fujii JAK2 amplicon H. sapiens GGTTTAATGGAAGAGAAGGG 70679 cut S. pyogenes... 70018 cut S. pyogenes 26541286 Voytas BCR/ABL amplicon H. sapiens GGCTCCCTTCAAGTGGGATG 70658 cut S. pyogenes...

  14. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...S. pyogenes Kamoun pUC119-gRNA 52255 Plant PCR template none S. pyogenes Sheen pRGEB31 51295 Plant BsaI...62201 Plant yes, cut S. pyogenes Hyg Chen pUC57-Simple-gRNA backbone 51306 Xenopus BsaI none S. pyogenes...Bacteria BsaI yes, activate S. pyogenes Marraffini pSimpleII-U6-tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s) 47868 Mammalian...MultiSite Gateway recombination-based cloning of complex polycistronic lentiviruses. Can express Cas9 with...

  15. Neurodegeneration Research Collection

    Type
    Collection
    ...loci seem to be associated with the disease and implicate a wide range of cellular processes. The vast majority...variation and lifestyle or environmental factors. For example, variations of Apolipoprotein E (APOE), such as...collection of neurological mouse models including complex and monogenic diseases. Alzforum (Link opens in...

  16. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...interacts only with their own target sites (for example, Cre with lox sites, Flp with FRT sites, Dre with...preferred codon usage will improve expression. For example, iCre or FLPo in mammalian cells may facilitate...translocation of a gene of interest. Using Cre or Flp as examples, here are a few popular recombinase-dependent ...

  17. COVID-19 Resources

    Type
    Collection
    ...virus Mammalian constructs Due to the size and complexity of the collection, all available Ginkgo SARS-...top General Plasmid Tools SHERLOCK and DETECTR - Simple, portable, and inexpensive platforms to reliably...Andrew Ellington's lab. High-surety isothermal amplification and detection of SARS-CoV-2, including with ...

  18. Rett Syndrome

    Type
    Collection
    ...methylated DNA and the recruitment of the NCoR complex for proper nervous system function. While there...expressing Cas9 and empty gRNA backbones. A few examples of additional CRISPR resources can be found below...cell line repository (Link opens in a new window) Sampled - one of the world's largest biorepositories (Link...

  19. Bacterial Expression Systems

    Type
    Collection
    ...transfer (FRET) and bimolecular fluorescence complementation (BiFC) are techniques that have been widely...compatible vectors for bimolecular fluorescence complementation experiments in plants. The Zinc Finger Consortium...Introduction to FRET Bimolecular Fluorescence Complementation Makes Visualizing Protein–Protein Interactions...

  20. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...using a pooled CRISPR library are far more complex than using CRISPR to modify a single genomic locus...screening experiments require electroporation to amplify the pooled library and the use of Next-Generation...3rd 6 12,727 Yeast Inducible CRISPRi Library – Ampl133 161829 Inhibition Yeast Tavazoie N/A 6-12 51,681...
Showing: 41 - 60 of 938 results