We narrowed to 62 results for: tet

...strain expressing two reporters and dCas9 under a P-tet promoter integrated in the chromosome at phage attachment...

... has also developed a set of Cre-dependent, hSyn-Tet inducible plasmids (Addgene #242782–242799) suitable...

...that allow for conditional (Cre-lox) or inducible (Tet) expression are available. To find plasmids containing...

...expression of XFP of Brainbow by incorporating a Tet-Off system to boost XFP expression. The increased...

...' end of tdTomato Reverse Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene Reverse TK-pA-R...origin Forward pBRforBam CTTGGAGCCACTATCGAC In pBR322 tet region, upstream of BamHI site Forward pBRforEco ...Forward pBRrevBam GGTGATGTCGGCGATATAGG In pBR322 tet region, downstream of BamHI site Reverse pCAG-F GCAACGTGCTGGTTATTGTG...

...as shRNAs and gRNAs. Additional Resources Tetracycline (Tet) Inducible Expression Plasmids 101: The Promoter...elongation factor promoter TRE Inducible Multiple Tetracycline response element promoter; often optimized for...

...fluoroquinolone ciprofloxacin, ciprobay, zagam, baytril, tetracycline, etc. are available for mycoplasma removal from...

...has used an inducible MitoTimer reporter using a Tet-on system (pTRE-Tight-MitoTimer) to show its usefulness...repressor plasmids from Scot Wolfe's lab. These include Tet-inducible CRISPR activators and repressor plasmids...

.../mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg/mL Tetracycline 10 mg/mL 10 µg/mL Notes: Unless otherwise indicated...

...procedure for xenograft experiments. B) Constructs for tet-inducible CRISPRa-AAV engineering. Adapted from Nguyen...

...lab also created constitutive (pCMV-dCas9-D3A) and Tet-dependent (TetO-dCas9-D3A) constructs. For lentiviral...

...mCherry etc.), recombinases (Cre, Flp etc.), and tetracycline drug induction systems (ttA or rtTA) are between...

... a lambda red phage, λTetR, that carries the tetracycline resistance gene and the lambda red repressor...

...2002). Lack of an Immune Response against the Tetracycline-Dependent Transactivator Correlates with Long-Term...

...unique tissue-specific promoters expressing GFP, tetracycline response elements, and shRNAs many of which ...inserting OsTIR1 into the "safe harbor" AAVS1 locus (a tet-inducible OsTIR1 plasmid is also available). Second...

...England Biolabs F' proA+B+ lacIq ∆(lacZ)M15 zzf::Tn10 (TetR) ∆(ara-leu) 7697 araD139 fhuA ∆lacX74 galK16 galE15.../mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg/mL Tetracycline 10 mg/mL 10 µg/mL *Carbenicillin can be used...

...only activated in the presence of tamoxifen. A tetracycline-regulated or other drug-inducible approach may...

...Plasmid 53225 MBP-MEK1 S218TAG/S222TAG ( aka. PCRT7 tetR pLtetO MBP-MEK1 XX Amp) Strain 52055 EcAR7 Plasmid...

...Luciferase Firefly TRE Lentiviral vector with dox- or tet-inducible luciferase expression Stephen Tapscott ...

...Gradinaru 117383-AAV1 TRE-DIO-eYFP An AAV genome with tet-inducible, Cre-dependent expression of the fluorescent...