We narrowed to 709 results for: abo.1

...gene, and a terminator, as in Figure 1). Next, up to six Level 1 modules can be assembled into a Level...consists of three sets of cloning vectors (Level 0, 1, and 2) which can be used in successive assembly steps... 0 parts are directionally assembled into a Level 1 vector creating a single transcriptional unit (for...maintain the final plasmid after transformation. Figure 1: Overview of the MoClo Toolkit components and assembly...Learn about modular cloning (MoClo) and find MoClo kits deposited with Addgene, including the MoClo Toolkit...building synthetic genetic circuits, engineering metabolic pathways, assembling gene-editing tools, and more...editing, functional genomics, and more complex metabolic engineering and synthetic biology, compatible ...

...30, 2018 and updated April 16, 2020. Figure 1: Comparison of SHERLOCK and DETECTR nucleic acid detection...Addgene Blog Learn about using toehold switches to detect Zika virus   Learn more about targeting RNA with...time-consuming, and complex to use outside of standard laboratories. In the case of the COVID-19 pandemic, qPCR ...with Cas13a (C2c2) Learn more about Cas12a (Cpf1) and its multiplex genome editing abilities Resources...

...and biotin plasmids at Addgene!     Figure 1: Indirect detection of target markers can be achieved..., you may want to look at other methods. In the above cases, a good alternative is using a two-protein... region of the primary antibody (Figure 1b). As above, the advantage of this system is increased flexibility...

...changing the target sequence present in the gRNA. Figure 1: Overview of the basic CRISPR mechanism. CRISPR was...from Staphylococcus aureus ) has a coding sequence ~1 kb shorter than SpCas9 while retaining the same basic...lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included in the gRNA-containing...efficiency and fidelity. Nature Communications , 13 (1), 1425. PMID: 35301321 Edraki, A., Mir, A., Ibraheim...interrogation by SpRY-Cas9. Nature Communications , 15 (1), 3663. PMID: 38688943 Hsu, P. D., Scott, D. A., Weinstein...increase its specificity. Nature Communications , 9 (1). PMID: 30082838 Maddalo, D., Manchado, E., Concepcion...CRISPR-Cas9 with Bacteriophage Proteins. Cell , 168 (1–2), 150-158.e10. PMID: 28041849 Sakuma, T., Nishikawa...

...Collection , or read on to learn more about these tools. Figure 1: A typical optogenetics experiment. A...algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited by blue light and permits nonspecific...based on the LOV2 domain of A. sativa phototropin 1 ~450–495 LOVTRAP Zdk binds to the LOV domain in the...diversifying and extending optogenetics. Cell, 141 (1), 154–165. https://doi.org/10.1016/j.cell.2010.02.037...limitations and future developments. Exp Physiol, 96 (1), 19–25. https://doi.org/10.1113/expphysiol.2009.051961...Biol, 1408 , 141–165. https://doi.org/10.1007/978-1-4939-3512-3_10 PMID: 26965121 Yizhar, O., Fenno, L...Learn about using Optogenetics plasmids in your lab, including microbial opsins and optical switch systems...

... or coding strand of the transcribed gene (Figure 1). The coding strand is the DNA strand that encodes...that is transcribed by the RNA polymerase. Figure 1: Simplified promoter region during transcription. ...Mammalian Strong promoter from human elongation factor 1 alpha PGK Constitutive Mammalian Promoter from phospholycerate...Learn about bacterial and eukaryotic promoters, including transcription and the transcription complex...your gene of interest is expressed. Promoters are about 100–1,000 base pairs long and are adjacent and typically...Inducible by arabinose Promoter of the arabinose metabolic operon trp Repressible by tryptophan Promoter ...

...mycoplasma can even escape 0.2-micron filters. Figure 1: Contamination! Tissue culture media often have indicators...mycoplasma contamination in your cell culture or you are about to begin a new cell culture project. If mycoplasmas...that are difficult to trace. These include the laboratory personnel, the serum, the cell culture media,...accounts for the largest source among those mentioned above. The contaminants can spread through dirty clothing...proliferating shortly. Once they are present in the laboratory environment, they are difficult to eradicate....

...Choose Option 1 or Option 2 based on the concentration of the pooled sample above. Option 1: Buffer exchange...NaH 2 PO 4 ∙H 2 O 1 L deionized water Adjust pH to 7.0 Autoclave or filter sterilize 1 M sodium phosphate...NaH 2 PO 4 ∙H 2 O 1 L deionized water Adjust pH to 7.0 Autoclave or filter sterilize 1 M of sodium phosphate...antibody to 1 mg/mL with PBS if needed. For long term storage, add sterile sodium azide to 1 mM. Option...start with about 250 mL of supernatant and add 250 µL of 100X protease inhibitor cocktail. Add 1 part Protein...concentration of the pooled sample is above 1.0 mg/mL proceed to Option 1 with a buffer exchange using a Zeba...purify recombinant antibodies. Workflow Timeline Day 1: Purify antibody Day 2 or later: Buffer exchange Equipment...

... provides information for both biosafety level 1 (BSL-1) and biosafety level 2 (BSL-2). The purpose of... BSL-2 Guidelines Remember, the BSL-1 laboratory guidelines above are expected to be followed in addition...guidelines provide steps to ensure you are working in BSL-1 and BSL-2 labs safely. Protocols...Safety for Biosafety Levels One and Two (BSL-1 and BSL-2) Intro to the Lab Bench Check out more protocols...each level has different safety requirements. BSL-1 is designated for those working with microbes that...BSL-2 includes all of the precautions needed in BSL-1, along with additional precautions to prevent injuries...container Fire blanket Fire extinguisher Guidelines BSL-1 Guidelines Before You Work Right after entering the...

...of Contents A. pLKO.1-TRC Cloning Vector A.1 The RNAi Consortium A.2 Map of pLKO.1 A.3 Related plasmids...Order oligos compatible with pLKO.1 C. Cloning shRNA oligos into pLKO.1 C.1 Recommended materials C.2 Annealing... References H.1 Published articles H.2 Web resources I. Appendix I.1 Sequence of pLKO.1 TRC-Cloning Vector...information Back to Top A. pLKO.1-TRC Cloning Vector A.1 The RNAi Consortium The pLKO.1 cloning vector is the backbone...marker encoded in pLKO.1 allows for convenient stable selection. Figure 1 : Map of pLKO.1 containing an shRNA...puromycin should be from 1-10 μg/mL in 1 μg/mL increments. d. Label plates from 1-10 and add appropriate...Appendix I.1. Sequence of pLKO.1 TRC-Cloning Vector Click here to see the sequence of pLKO.1 TRC-cloning...

...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward...CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse... design your own primers . Still have questions about choosing the best primer for your plasmid? Email...

...7.5% Sodium Bicarbonate, 7.5 mL 1 M HEPES to 750 mL DMEM + 1 g/L glucose. 1 mg/mL polyethylenimine (PEI) ...Calculate the amount of each plasmid needed to have a 1:1:1 molar ratio with 2 mg total DNA per CS5 Plasmid ... determine the total μg/bp we need to achieve a 1:1:1 molar ratio of each plasmid: 2000 μg / 24,961 bp...deionized water + 100 mL of 1 M Tris HCl pH 8.5 + 60 mL of 5 M Sodium Chloride + 4 mL of 1 M Magnesium Chloride...high glucose, Corning 10-013-CV DMEM, low glucose (1 g/L) glucose, sodium pyruvate, Corning 10-014-CV (... sodium bicarbonate, Corning 25-035-CI (optional) 1 M HEPES, HyClone SH30237.01 (optional) L-alanyl-L-glutamine...cations can affect the attachment of adherent cells) 1 mg/mL Polyethylenimine (PEI) 25 kDa MW Pro-Tip Other...

...Bachelor's degree Generally a short-term position (1-2 years) Often a gap-year position taken to transition...dig deep Talk to your professors about their research, and learn about what makes them excited to do what...sciences), people conduct research to answer questions about how the world works. As scientists, we probe beyond...curious person. I like to ask questions and think about the best way to answer those questions. I’ve met...enjoy, is worthwhile and can help us make decisions about what we want to do in the future. How do I get started...sense of what kind of research you would be excited about. I know quite a few friends who opted to join labs... a lot out there worth exploring! Being excited about the science allows you to ask more interesting questions...

...replication and also act as signals for packaging. Figure 1: Wild-type AAV genome. AAVs are part of the Dependoparvovirus...extensively studied, and has a broad tissue tropism. Table 1 gives a summary of the tropism of AAV serotypes, indicating...AAV5, AAV8 Skeletal muscle AAV1, AAV8, AAV9 Table 1: Summary of tissue tropism displayed by different ...transgene, but also at a very low efficiency (less than 1% of wild-type). Another split AAV method which has...vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell...our adeno-associated viral vector guide to learn about AAV vector components, production and common uses...E2a and VA for replication. For more information about adenovirus, read our Adenoviral Vector Guide . Recombinant...

...enzyme and guide RNA) for your experiment (Figure 1). You will decide how to express Cas9, the delivery...finally how to validate your genetic edit. Figure 1: Flow chart describing the general framework of a ...population. Some cells may remain wild type due to either (1) a lack of gRNA and/or Cas9 expression or (2) a lack...Biology , 1239 , 197–217. https://doi.org/10.1007/978-1-4939-1862-1_10 PMID: 25408407 Dixit, A., Parnas, O...exon coding for an essential protein domain could abolish protein activity and essentially function as a ...reference sequence you used for gRNA design. Read more about how to design your gRNA . Synthesize and Clone Desired... other downstream methods. For more information about viral vectors and their production, see our viral...

...experience in cancer research After graduating with a 2:1 BSc in Molecular Biology (roughly a B average in the...really passionate about during my degree. I loved parasitology. However, when I enquired about roles in this...with an overview of my experience and how I felt about the different positions to enable them to decide...

...tissues: use 1 mL of Solution D per 100 mg of cells. For cultured cells: use 1 mL of Solution D per 1 X 10 7...tissues: use 1 mL of TRIzol® per 100 mg of cells. For cultured cells: use 1 mL of TRIzol® per 1 X 10 7 cells... to 1 mL of lysate: Add 0.1 mL of 2 M sodium acetate (pH 4.0), mix thoroughly by inversion. Add 1 mL water-saturated...Option A): Add 1 volume of Isopropanol to the extracted aqueous layer. Incubate at -20°C for 1 hour. Lithium.... Add 0.2 mL of Chloroform/Isoamyl alcohol (49:1) per 1 mL of TRIzol® used. Shake vigorously by hand for...with the volatile reagents in the list above. Procedure Option #1 - Solution D Protocol Before starting...

...Levels One and Two (BSL-1 and BSL-2) Safety measures for laboratories operating at BSL-1 and BSL-2 Watch the...(PPE) for BSL-1 and BSL-2 Labs Learn how to best protect yourself when working in BSL-1 and BSL-2 labs... T4 polymerase pLKO.1 - TRC Cloning Vector Cloning protocols for using the pLKO.1 vector, a backbone used...maintenance and use Watch the Video! Pipetting Learn about selecting the correct pipettor and pipette tip, ...the pipette Watch the Video! Centrifugation Learn about selecting and using a centrifuge to separate different... a liquid sample Using a Light Microscope Learn about the parts of a light microscope and its use Weighing...Weighing Reagents Learn how to weigh laboratory materials on a balance Basic Molecular Biology These protocols...

...halorhodopsins to silence neuronal activity (Figure 1) (Wiegert et al., 2017). How to get an opsin into...FLEx enters the scene. FLEx: A light when night is about you! The FLEx (for flip-excision) switch (aka DIO...PMC4166436. Resources on the Addgene blog Learn more about FLEx vectors Download our Plasmids 101 eBook Read...

... DNA fragments of interest, such as genes. Figure 1: Creation of recombinant DNA. Working with Plasmids...U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 tonA EPI300 LGC Biosearch Technologies...Addgene; Promega e14-(McrA-) recA1 endA1 gyrA96 thi-1 hsdR17(rK- mK+) supE44 relA1 Δ(lac- proAB) [F traΔ36...galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ- leu mtl-1 Top10 Invitrogen F- mcrA Δ(mrr-hsdRMS-mcrBC) Phi80lacZM15...Learn about the basics of molecular biology, including molecular genetics, plasmids, sequencing, and ...human genome with restriction enzymes would yield about two million DNA fragments, which is far too many...can be replicated easily and efficiently in a laboratory setting. Are stable — Plasmids are stable long-term...