We narrowed to 702 results for: abo.1

...Choose Option 1 or Option 2 based on the concentration of the pooled sample above. Option 1: Buffer exchange...NaH 2 PO 4 ∙H 2 O 1 L deionized water Adjust pH to 7.0 Autoclave or filter sterilize 1 M sodium phosphate...NaH 2 PO 4 ∙H 2 O 1 L deionized water Adjust pH to 7.0 Autoclave or filter sterilize 1 M of sodium phosphate...antibody to 1 mg/mL with PBS if needed. For long term storage, add sterile sodium azide to 1 mM. Option...start with about 250 mL of supernatant and add 250 µL of 100X protease inhibitor cocktail. Add 1 part Protein...concentration of the pooled sample is above 1.0 mg/mL proceed to Option 1 with a buffer exchange using a Zeba...purify recombinant antibodies. Workflow Timeline Day 1: Purify antibody Day 2 or later: Buffer exchange Equipment...

... provides information for both biosafety level 1 (BSL-1) and biosafety level 2 (BSL-2). The purpose of... BSL-2 Guidelines Remember, the BSL-1 laboratory guidelines above are expected to be followed in addition...guidelines provide steps to ensure you are working in BSL-1 and BSL-2 labs safely. Protocols...Safety for Biosafety Levels One and Two (BSL-1 and BSL-2) Intro to the Lab Bench Check out more protocols...each level has different safety requirements. BSL-1 is designated for those working with microbes that...BSL-2 includes all of the precautions needed in BSL-1, along with additional precautions to prevent injuries...container Fire blanket Fire extinguisher Guidelines BSL-1 Guidelines Before You Work Right after entering the...

...of Contents A. pLKO.1-TRC Cloning Vector A.1 The RNAi Consortium A.2 Map of pLKO.1 A.3 Related plasmids...Order oligos compatible with pLKO.1 C. Cloning shRNA oligos into pLKO.1 C.1 Recommended materials C.2 Annealing... References H.1 Published articles H.2 Web resources I. Appendix I.1 Sequence of pLKO.1 TRC-Cloning Vector...information Back to Top A. pLKO.1-TRC Cloning Vector A.1 The RNAi Consortium The pLKO.1 cloning vector is the backbone...marker encoded in pLKO.1 allows for convenient stable selection. Figure 1 : Map of pLKO.1 containing an shRNA...puromycin should be from 1-10 μg/mL in 1 μg/mL increments. d. Label plates from 1-10 and add appropriate...Appendix I.1. Sequence of pLKO.1 TRC-Cloning Vector Click here to see the sequence of pLKO.1 TRC-cloning...

...Bachelor's degree Generally a short-term position (1-2 years) Often a gap-year position taken to transition...dig deep Talk to your professors about their research, and learn about what makes them excited to do what...sciences), people conduct research to answer questions about how the world works. As scientists, we probe beyond...curious person. I like to ask questions and think about the best way to answer those questions. I’ve met...enjoy, is worthwhile and can help us make decisions about what we want to do in the future. How do I get started...sense of what kind of research you would be excited about. I know quite a few friends who opted to join labs... a lot out there worth exploring! Being excited about the science allows you to ask more interesting questions...

...7.5% Sodium Bicarbonate, 7.5 mL 1 M HEPES to 750 mL DMEM + 1 g/L glucose. 1 mg/mL polyethylenimine (PEI) ...Calculate the amount of each plasmid needed to have a 1:1:1 molar ratio with 2 mg total DNA per CS5 Plasmid ... determine the total μg/bp we need to achieve a 1:1:1 molar ratio of each plasmid: 2000 μg / 24,961 bp...deionized water + 100 mL of 1 M Tris HCl pH 8.5 + 60 mL of 5 M Sodium Chloride + 4 mL of 1 M Magnesium Chloride...high glucose, Corning 10-013-CV DMEM, low glucose (1 g/L) glucose, sodium pyruvate, Corning 10-014-CV (... sodium bicarbonate, Corning 25-035-CI (optional) 1 M HEPES, HyClone SH30237.01 (optional) L-alanyl-L-glutamine...cations can affect the attachment of adherent cells) 1 mg/mL Polyethylenimine (PEI) 25 kDa MW Pro-Tip Other...

...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward...CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse... design your own primers . Still have questions about choosing the best primer for your plasmid? Email...

...experience in cancer research After graduating with a 2:1 BSc in Molecular Biology (roughly a B average in the...really passionate about during my degree. I loved parasitology. However, when I enquired about roles in this...with an overview of my experience and how I felt about the different positions to enable them to decide...

...replication and also act as signals for packaging. Figure 1: Wild-type AAV genome. Created with BioRender.com....extensively studied, and has a broad tissue tropism. Table 1 gives a summary of the tropism of AAV serotypes, indicating...AAV5, AAV8 Skeletal muscle AAV1, AAV8, AAV9 Table 1: Summary of tissue tropism displayed by different ...transgene, but also at a very low efficiency (less than 1% of wild-type). Another split AAV method which has...vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell...our adeno-associated viral vector guide to learn about AAV vector components, production and common uses...E2a and VA for replication. For more information about adenovirus, read our Adenoviral Vector Guide . Recombinant...

...halorhodopsins to silence neuronal activity (Figure 1) (Wiegert et al., 2017). How to get an opsin into...FLEx enters the scene. FLEx: A light when night is about you! The FLEx (for flip-excision) switch (aka DIO...PMC4166436. Resources on the Addgene blog Learn more about FLEx vectors Download our Plasmids 101 eBook Read...

...tissues: use 1 mL of Solution D per 100 mg of cells. For cultured cells: use 1 mL of Solution D per 1 X 10 7...tissues: use 1 mL of TRIzol® per 100 mg of cells. For cultured cells: use 1 mL of TRIzol® per 1 X 10 7 cells... to 1 mL of lysate: Add 0.1 mL of 2 M sodium acetate (pH 4.0), mix thoroughly by inversion. Add 1 mL water-saturated...Option A): Add 1 volume of Isopropanol to the extracted aqueous layer. Incubate at -20°C for 1 hour. Lithium.... Add 0.2 mL of Chloroform/Isoamyl alcohol (49:1) per 1 mL of TRIzol® used. Shake vigorously by hand for...with the volatile reagents in the list above. Procedure Option #1 - Solution D Protocol Before starting...

...enzyme and guide RNA) for your experiment (Figure 1). You will decide how to express Cas9, the delivery...finally how to validate your genetic edit. Figure 1: Flow chart describing the general framework of a ...population. Some cells may remain wild type due to either (1) a lack of gRNA and/or Cas9 expression or (2) a lack...Biology , 1239 , 197–217. https://doi.org/10.1007/978-1-4939-1862-1_10 PMID: 25408407 Dixit, A., Parnas, O...exon coding for an essential protein domain could abolish protein activity and essentially function as a ...reference sequence you used for gRNA design. Read more about how to design your gRNA . Synthesize and Clone Desired... other downstream methods. For more information about viral vectors and their production, see our viral...

...Levels One and Two (BSL-1 and BSL-2) Safety measures for laboratories operating at BSL-1 and BSL-2 Watch the...(PPE) for BSL-1 and BSL-2 Labs Learn how to best protect yourself when working in BSL-1 and BSL-2 labs... T4 polymerase pLKO.1 - TRC Cloning Vector Cloning protocols for using the pLKO.1 vector, a backbone used...maintenance and use Watch the Video! Pipetting Learn about selecting the correct pipettor and pipette tip, ...the pipette Watch the Video! Centrifugation Learn about selecting and using a centrifuge to separate different... a liquid sample Using a Light Microscope Learn about the parts of a light microscope and its use Weighing...Weighing Reagents Learn how to weigh laboratory materials on a balance Basic Molecular Biology These protocols...

... DNA fragments of interest, such as genes. Figure 1: Creation of recombinant DNA. Working with Plasmids...U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 tonA EPI300 LGC Biosearch Technologies...Addgene; Promega e14-(McrA-) recA1 endA1 gyrA96 thi-1 hsdR17(rK- mK+) supE44 relA1 Δ(lac- proAB) [F traΔ36...galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ- leu mtl-1 Top10 Invitrogen F- mcrA Δ(mrr-hsdRMS-mcrBC) Phi80lacZM15...Learn about the basics of molecular biology, including molecular genetics, plasmids, sequencing, and ...human genome with restriction enzymes would yield about two million DNA fragments, which is far too many...can be replicated easily and efficiently in a laboratory setting. Are stable — Plasmids are stable long-term...

...95 10 2 1 Denaturation 94 0.5 2 40 Annealing/Extension 60 1 2 40 Enzyme Deactivation 98 10 2 1 Hold 4 ... primers/probe (FAM) 1 µL 9 µL 900 nM, 250 nM 20X RPP30 primers/probe (HEX/VIC) 1 µL 9 µL 900 nM, 250 .... Last Update: July 7, 2023 Workflow Timeline Day 1: Seed and transduce cells Day 4: Treat cells with ...Cycler, Bio-Rad, T100 PCR Plate Sealer, Bio-Rad, PX1 1–10 µL single channel pipette 20–200 µL single channel...TrypLE, Thermo Fisher, 12605010) Ethanol, VWR, EX0276-1 Benzonase 250 U/µl, Millipore #71205-3 Polybrene 10... each viral dilution to a well of a 6-well plate (1 dilution per well). Leave one well untransduced (add...suspension well before seeding. Mix each well with a 1 mL pipette 5–10 times. The final volume in the well...

...Because this is such a small volume, first make 1 mL of a 1:100 dilution of the homogenized cell solution... were transduced with lentiCas9-Blast 1 and then selected with 1 μg/mL blasticidin for 9 days. Single ...with lentiCas9-Blast 1 . A549 cells were transduced (MOI = 37) and selected with 1 μg/mL blasticidin for...conditioned medium (see below for more details) Day 1: Seed individual cells in a 96-well plate Day 2–14...final 5 cell/mL solution, transfer 12.5 µL of the 1:100 dilution to 10 mL of conditioned medium. Transfer...cells will appear as colonies in the well ( Figure 1 ). You will be able to tell if there was more than...transgene expression ( Figure 2 ). Sample Data Figure 1: Generation of monoclonal cell lines from expansion...

...Biolabs B7022S Procedure Pouring a Standard 1% Agarose Gel: Measure 1 g of agarose. Pro-Tip Agarose gels are...of the way down the gel. A typical run time is about 1-1.5 hours, depending on the gel concentration and...different buffers and do not use water). Microwave for 1-3 min until the agarose is completely dissolved (but...sample. Note: Loading buffer serves two purposes: 1) it provides a visible dye that helps with gel loading...cool down to about 50 °C (about when you can comfortably keep your hand on the flask), about 5 mins. Optional...concentration of approximately 0.2-0.5 μg/mL (usually about 2-3 μl of lab stock solution per 100 mL gel). EtBr... of the tip of the pipette into the buffer just above the well. Very slowly and steadily, push the sample...

... resistance) Procedure Day 1 Prepare carbenicillin to a concentration of 1 mg/mL – 4 mg/mL in LB medium...lawn of E. coli and no apparent selection. 150 µL of 1 mg/mL Carbenicillin plated over-agar Plate shows several...over-agar Plate shows less individual colonies than the 1 mg/mL plate and effective selection. 150 µL of 4 mg...several individual colonies with smaller size than the 1 mg/mL and 2 mg/mL plates and effective selection. ...coli after Over-Agar Plating of Carbenicillin. The above graph displays the stock concentration of Carbenicillin...concentrations that will work for this assay, and the above result represents a single experiment. For publishable...

.... Blot the coverslip with a laboratory wipe to remove excess liquid. Add 1 drop of anti-fade mounting ...Last Update: January 20, 2022 Workflow Timeline Day 1: Seed cells Day 3-4: Fix and label cells Equipment...into 5 mL PBS. Protect from light. Procedure Section 1: Seeding cells Place a sterile poly-D-lysine coated...concentration will vary but generally ranges from 1-10 µg/mL. Add 500 µL of the diluted antibody to the...concentration will vary but generally ranges from 1-10 µg/mL. Add 500 µL fluorescently-labeled secondary...water Microscope slide Anti-fade mounting medium Laboratory wipes 15 mL conical tubes 50 mL conical tubes...paraformaldehyde and follow your institution's laboratory safety guidelines for disposing of waste in the...

... for both biosafety level 1 (BSL-1) and biosafety level 2 (BSL-2). The BSL-1 classification is for labs...(PPE) for BSL-1 and BSL-2 labs. Protocols... Protocols Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs...Labs Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs Intro to the Lab Bench Check out more ...BSL-2 includes all of the precautions needed in BSL-1, however there are additional precautions that lie...always wear glasses/goggles in addition to the BSL-1 requirements. Conclusion Although simple, following...and bathroom. These items should remain in the laboratory. When traveling between lab spaces, take your...

...Dilution 1 (20X): 5 µL in 95 µL 1X PCR buffer (1:20) Dilution 2 (20X): 5 µL in 95 µL 1X PCR buffer (1:400)...95 10 2 1 Denaturation 95 0.5 2 50 Annealing/Extension 60 1 2 50 Signal Stabilization 98 10 2 1 Hold 4 ...Use a single channel 1–10 µL pipette to add 5 µL of each viral sample to Dilution 1 in the 48-well dilution... 95 µL 1X PCR buffer (1:8,000) Dilution 4 (20X): 5 µL in 95 µL 1X PCR buffer (1:160,000) Dilution 5 (20X...95 µL 1X PCR buffer (1:3,200,000) Dilution 6 (2X): 50 µL in 50 µL 1X PCR buffer (1:6,400,000) Dilution ...50 µL 1X PCR buffer (1:12,800,000) Dilution 8 (2X): 50 µL in 50 µL 1X PCR buffer (1:25,600,000) Use multichannel...pipettes for the dilution series. For dilutions 1–5, use the 1–10 µL multichannel pipette set to 5 µL. For...