Skip to main content

We narrowed to 15 results for: abo.1

Showing: 1 - 15 of 15 results
  1. Adenovirus Guide

    Type
    Guide
    ...to an antigen. AdEasier-1 cells BJ5183 E. coli cells containing the pAdEasy-1 packaging plasmid. Adenovirus...icosahedral capsids and build new virions. Figure 1: Wild-type adenovirus and its genome. Genes over or... This construct is then transformed into AdEasier-1 cells (Addgene #16399) , which are BJ5183 E. coli ... viruses. The adenoviral backbone plasmid pAdEasy-1 (Addgene #16400) is suitable for most purposes. For...production system. Figure is based on the use of pAdEasy-1. AdMax™ AdMax™ is another well used rAdV vector production...landscape . Signal Transduction and Targeted Therapy, 6 (1), 53. https://doi.org/10.1038/s41392-021-00487-6 (...as a Zika virus vaccine . Scientific Reports, 10 (1), 3613. https://doi.org/10.1038/s41598-020-60238-5...
  2. Chemogenetics Guide

    Type
    Guide
    ...Addgene's Chemogenetics Plasmid Collection . Figure 1: General overview of a chemogenetics experiment. Early...bidirectional control of neuronal activity. Table 1: Descriptions of DREADDs and their activity in neurons... while PSAMs and LMOs have an effect for only 0.5–1 hours after delivery. Chemogenetic Ligand The chemogenetic...Causal Cellular and Neuronal Biology. Physiol Rev, 98 (1), 391–418. https://doi.org/10.1152/physrev.00009.2017...Neurophotonics 11 (2), 021005. https://doi.org/10.1117/1.NPh.11.2.021005 PMID: 38450294 Coward, P., Wada, H... Gi-coupled receptor. Proc Natl Acad Sci USA, 95 (1), 352–357. https://doi.org/10.1073/pnas.95.1.352 PMID... 451–460. https://doi.org/10.1007/s00213-004-2017-1 PMID: 15765260 Farrell, M. S., Pei, Y., Wan, Y., Yadav...
  3. Lentiviral Vector Guide

    Type
    Guide
    ...production in the laboratory, and many have been removed or mutated for increased safety. Figure 1: Wild-type...typically ranges from 8–10 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...genes (for example, vif , vpr , vpu , and nef for HIV-1). The LTRs flank all of these genes, and anything ...transgene and LTRs (chimeric 5’ LTR) Packaging plasmid 1 — contains gag and pol Packaging plasmid 2 — contains...and third-generation systems, please refer to Table 1. Figure 4: Third-generation lentiviral plasmids. Feature...heterologous enhancer/promoter such as CMV or RSV Table 1. Summary of key differences between second- and third-generation...More Lentiviral Vector topics Addgene Protocols pLKO.1 - TRC Cloning Vector Protocols Lentiviral Vector Production...
  4. Modular Cloning Guide

    Type
    Guide
    ...gene, and a terminator, as in Figure 1). Next, up to six Level 1 modules can be assembled into a Level...consists of three sets of cloning vectors (Level 0, 1, and 2) which can be used in successive assembly steps... 0 parts are directionally assembled into a Level 1 vector creating a single transcriptional unit (for...maintain the final plasmid after transformation. Figure 1: Overview of the MoClo Toolkit components and assembly...Learn about modular cloning (MoClo) and find MoClo kits deposited with Addgene, including the MoClo Toolkit...building synthetic genetic circuits, engineering metabolic pathways, assembling gene-editing tools, and more...editing, functional genomics, and more complex metabolic engineering and synthetic biology, compatible ...
  5. CRISPR Guide

    Type
    Guide
    ...changing the target sequence present in the gRNA. Figure 1: Overview of the basic CRISPR mechanism. CRISPR was...from Staphylococcus aureus ) has a coding sequence ~1 kb shorter than SpCas9 while retaining the same basic...lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included in the gRNA-containing...efficiency and fidelity. Nature Communications , 13 (1), 1425. PMID: 35301321 Edraki, A., Mir, A., Ibraheim...interrogation by SpRY-Cas9. Nature Communications , 15 (1), 3663. PMID: 38688943 Hsu, P. D., Scott, D. A., Weinstein...increase its specificity. Nature Communications , 9 (1). PMID: 30082838 Maddalo, D., Manchado, E., Concepcion...CRISPR-Cas9 with Bacteriophage Proteins. Cell , 168 (1–2), 150-158.e10. PMID: 28041849 Sakuma, T., Nishikawa...
  6. Optogenetics Guide

    Type
    Guide
    ...Collection , or read on to learn more about these tools. Figure 1: A typical optogenetics experiment. A...algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited by blue light and permits nonspecific...based on the LOV2 domain of A. sativa phototropin 1 ~450–495 LOVTRAP Zdk binds to the LOV domain in the...diversifying and extending optogenetics. Cell, 141 (1), 154–165. https://doi.org/10.1016/j.cell.2010.02.037...limitations and future developments. Exp Physiol, 96 (1), 19–25. https://doi.org/10.1113/expphysiol.2009.051961...Biol, 1408 , 141–165. https://doi.org/10.1007/978-1-4939-3512-3_10 PMID: 26965121 Yizhar, O., Fenno, L...Learn about using Optogenetics plasmids in your lab, including microbial opsins and optical switch systems...
  7. Promoters

    Type
    Guide
    ... or coding strand of the transcribed gene (Figure 1). The coding strand is the DNA strand that encodes...that is transcribed by the RNA polymerase. Figure 1: Simplified promoter region during transcription. ...Mammalian Strong promoter from human elongation factor 1 alpha PGK Constitutive Mammalian Promoter from phospholycerate...Learn about bacterial and eukaryotic promoters, including transcription and the transcription complex...your gene of interest is expressed. Promoters are about 100–1,000 base pairs long and are adjacent and typically...Inducible by arabinose Promoter of the arabinose metabolic operon trp Repressible by tryptophan Promoter ...
  8. Sequencing Primers

    Type
    Guide
    ...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward...CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse... design your own primers . Still have questions about choosing the best primer for your plasmid? Email...
  9. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...replication and also act as signals for packaging. Figure 1: Wild-type AAV genome. AAVs are part of the Dependoparvovirus...extensively studied, and has a broad tissue tropism. Table 1 gives a summary of the tropism of AAV serotypes, indicating...AAV5, AAV8 Skeletal muscle AAV1, AAV8, AAV9 Table 1: Summary of tissue tropism displayed by different ...transgene, but also at a very low efficiency (less than 1% of wild-type). Another split AAV method which has...vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell...our adeno-associated viral vector guide to learn about AAV vector components, production and common uses...E2a and VA for replication. For more information about adenovirus, read our Adenoviral Vector Guide . Recombinant...
  10. Plan Your Experiment

    Type
    Guide
    ...enzyme and guide RNA) for your experiment (Figure 1). You will decide how to express Cas9, the delivery...finally how to validate your genetic edit. Figure 1: Flow chart describing the general framework of a ...population. Some cells may remain wild type due to either (1) a lack of gRNA and/or Cas9 expression or (2) a lack...Biology , 1239 , 197–217. https://doi.org/10.1007/978-1-4939-1862-1_10 PMID: 25408407 Dixit, A., Parnas, O...exon coding for an essential protein domain could abolish protein activity and essentially function as a ...reference sequence you used for gRNA design. Read more about how to design your gRNA . Synthesize and Clone Desired... other downstream methods. For more information about viral vectors and their production, see our viral...
  11. Molecular Biology Reference

    Type
    Guide
    ... DNA fragments of interest, such as genes. Figure 1: Creation of recombinant DNA. Working with Plasmids...U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 tonA EPI300 LGC Biosearch Technologies...Addgene; Promega e14-(McrA-) recA1 endA1 gyrA96 thi-1 hsdR17(rK- mK+) supE44 relA1 Δ(lac- proAB) [F traΔ36...galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ- leu mtl-1 Top10 Invitrogen F- mcrA Δ(mrr-hsdRMS-mcrBC) Phi80lacZM15...Learn about the basics of molecular biology, including molecular genetics, plasmids, sequencing, and ...human genome with restriction enzymes would yield about two million DNA fragments, which is far too many...can be replicated easily and efficiently in a laboratory setting. Are stable — Plasmids are stable long-term...
  12. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...safety when producing viral vectors in a laboratory setting. Figure 1: Wild-type gamma-retrovirus genome. ...gamma-retroviruses ranges from 9–11 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...Read our gamma-retroviral guide to learn about gamma-retroviral components, retroviral production, and...gamma-retroviral vectors that can be safely used in laboratory settings. These engineered gamma-retroviral vectors...of plasmids, as lentiviral vectors do. For more about lentiviruses, see Addgene's lentiviral vector guide...packaging methods . The three plasmids described above (envelope, packaging, and transfer) are co-transfected... Design. In Retroviruses . Cold Spring Harbor Laboratory Press. NIH Bookshelf De Ravin, S. S., Su, L.,...
  13. Antibody Guide

    Type
    Guide
    ...and placed in a buffer. Antibody Structure Figure 1: Structure of an antibody A standard antibody is made... together to form a “Y” shape, as shown in Figure 1. The two arms of the Y structure are responsible for...are often used in clinical applications. Diabodies - Diabodies contain two Fab fragments, each recognizing...cells isolated from animals immunized as described above are used to create hybridomas, which produce large...different epitope, bound by short peptide linkers. Diabodies can be used for assembling protein nanostructures... Includes: Flow cytometry Read on to learn more about the applications common to each category, including...controls, and any special considerations to think about. For step-by-step instructions of many of these ...
  14. Guide to Using Pooled Libraries

    Type
    Guide
    ...also negatively affect data reproducibility. Figure 1: Simplified flow chart for amplifying and using a ...Learn all about plasmid pooled libraries, how to amplify and use them, and what types of experiments ...variant effect mapping studies. You can learn more about CRISPR tools in our CRISPR Guide . There are multiple...for the best results. If you have any questions about the library protocols, feel free to contact us at...simultaneously in a single reaction. As discussed above, access to this technology is crucial for conducting...Resources Addgene Pooled Library Resources Learn about Pooled Library Handling and Storage . Deposit a ...
  15. Molecular Cloning Techniques

    Type
    Guide
    ...more in our Restriction Cloning blog post . Figure 1: Restriction enzyme cloning of your gene of interest...Learn about different molecular cloning techniques, focusing on seven common cloning methods. Educational...
Showing: 1 - 15 of 15 results