Skip to main content

We narrowed to 705 results for: ESC;

Showing: 681 - 700 of 705 results
  1. E11 Bio PRISM Collection

    Type
    Collection
    ...Sheridan et al. (2025). PRISM Plasmids ID Plasmid Description Tags Additional Resources PRISM was developed...
  2. AAV for Neuronal Tracing

    Type
    Collection
    ...Vectors for Monosynaptic Neuronal Tracing ID Name Description Serotype PI 52473 pAAV-synP-FLEX-splitTVA-EGFP-B19G...
  3. p53 Pathway

    Type
    Collection
    ...in promoting cell cycle arrest, apoptosis, or senescence in damaged cells. The p53 name arose from its...
  4. Open Enzyme Collection

    Type
    Collection
    ...codon-optimized the Open Enzymes parts for expression in Escherichia coli . Researchers can use the collection as ...
  5. Deisseroth INTRSECT Collection

    Type
    Collection
    ...Gray Facilitate the Itch-Scratching Cycle via Descending Regulation. Neuron 101(1):45-59. PubMed (Link...
  6. The Pleiades Promoter Project

    Type
    Collection
    ...individual plasmid webpages. These plasmids are described in Portales-Casamar et al., 2010 . List of Pleiades...
  7. Biosensor AAV Preps

    Type
    Collection
    ...Service: Biosensor AAV Browse our AAV that express fluorescent biosensor proteins, including calcium sensors...
  8. Chemogenetics Guide

    Type
    Guide
    ...option. Coupling brighter bioluminescent modules, such as luciferase-fluorescent protein fusions, to more-sensitive... routes. Image courtesy of Ute Hochgeschwender . Table 3: Descriptions of LMOs and their activity in neurons... alternative DREADD ligands. Compound 21, deschloroclozapine (DCZ), perlapine, and olanzapine have all...bidirectional control of neuronal activity. Table 1: Descriptions of DREADDs and their activity in neurons DREADD...their effect, and outcome in neurons. Table 2: Descriptions of PSAMs and their activity in neurons PSAM ...Magnus et al., 2011 LMOs Luminopsins (LMOs), or luminescent opsins, are opto-chemogenetic fusion proteins...Rossi, M. A., Augustine, G. J., Yin, H. H., & Hochgeschwender, U. (2016). Luminopsins integrate opto- and...
  9. Antibody Guide

    Type
    Guide
    ... is described in more detail in the Multiplex Assays section below. The following table describes the ...performs a chemiluminescent reaction in the presence of several different substrates. The luminescence produced...wells) by fluorescence activated cell sorting (FACS). Figure 7: Flow cytometry uses fluorescently-labeled...of B cells isolated from animals immunized as described above are used to create hybridomas, which produce...each antibody has two binding sites. Isotype Description Configuration and Valency Subclasses IgA Prevalent... to visualize protein location. Includes: Immunofluorescence (IF) Immunohistochemistry (IHC) Immunocytochemistry...primary antibody for your protein of interest, as described in the IP section above. Reverse the crosslink...
  10. Sequencing Primers

    Type
    Guide
    ...promoter Reverse pBluescript KS TCGAGGTCGACGGTATC For pBluescript vector Forward pBluescript SK TCTAGAACTAGTGGATC...promoter Reverse pBluescriptKS TCGAGGTCGACGGTATC For pBluescript vector Forward pBluescriptSK TCTAGAACTAGTGGATC... Sequencing Primers Name Sequence (5' to 3') Description Direction BGH-R TAGAAGGCACAGTCGAGG Bovine growth...TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' end of MCS in pGEX vectors... Sequencing Primers Name Sequence (5' to 3') Description Direction 3'AOX1 GCAAATGGCATTCTGACATCC For Pichia...TCTAGAACTAGTGGATC For pBluescript vector Reverse pBMN 5' GCTTGGATACACGCCGC MMLV sequence, for inserts in pBMN retroviral...
  11. Molecular Biology Reference

    Type
    Guide
    ...General structure of a plasmid. Plasmid Element Description Origin of Replication ( ori ) DNA sequence which...the control of a non-bacterial promoter or a fluorescent protein to select or sort the cells by visualization... prior to use in an experiment. Plasmid Type Description Addgene Resource(s) Cloning Plasmids Used to ...level of transcription driven by that promoter. Fluorescent Protein Plasmids , Luciferase Plasmids Viral ...commercial lab strains of E. coli used today are descended from two individual isolates, the K-12 strain ...relies on the random incorporation of modified, fluorescently-tagged bases during in vitro DNA replication... DNA because the ultimate goal is to have a fluorescently-tagged nucleotide at each position in the DNA...
  12. CRISPR Guide

    Type
    Guide
    ...catalytically inactive dCas9 to a fluorescent marker like green fluorescent protein (GFP), creating a customizable... sequences using a fluorescent reporter. In SHERLOCK, a quenched ssRNA fluorescent reporter is added to...have been created by directed evolution of the Escherichia coli TadA, a tRNA adenosine deaminase. Like cytosine...customizable DNA or RNA label for fluorescence microscopy. RNA aptamers, like MS2 or PP7, can also be fused...fused to the gRNA to recruit fluorescently-tagged RNA-binding proteins (RBPs). Multicolor CRISPR imaging...dCas9 and S. aureus dCas9) tagged with different fluorescent proteins or by fusing the gRNAs to orthogonal...imaging of genomic loci, as in the CRISPR-Sirius . Fluorescent CRISPR systems have been used for dynamic tracking...
  13. Optogenetics Guide

    Type
    Guide
    ...cell membrane. Microbial opsins, such as those described below, can be targeted and expressed in specific... Microbial Opsin Variants Opsin Type Variant Description Peak Response Spectra (nm) Channelrhodopsins:...dimerization. In addition to the applications described above, both LOV and Dronpa can control activity...Collection for your next experiment. For a full description of different domains used in these plasmids, ...Glossary of Optical Switches Category Variant Description Peak Response Spectra (nm) BLUF domains bPAC ...activator FixJ in the absence of blue light. 470 Fluorescent Protein domains Dronpa based Light-inducible ...engineered from a green-to-red photoconvertible fluorescent protein 400 UVR8 domains UVR8 plant photoreceptor...
  14. Modular Cloning Guide

    Type
    Guide
    ...MoClo kits in our collection. Kit name Type PI Description MoClo Toolkit Plant Expression Sylvestre Marillonnet...PhytoBrick parts. MoBiFC - Modular Bimolecular Fluorescence Complementation Toolkit Plant Expression Benjamin...Field 50 plasmids for assembling bimolecular fluorescence complementation experiments to analyze protein-protein...Volker Sieber Plasmids with control elements and fluorescent reporters to be used in combination with the ...synthetic terminators, protein purification tags and fluorescence proteins for use in E. coli for a variety of...Christopher Dupont 95 plasmids including backbones, fluorescent proteins, protein tags, and signal peptides, ...
  15. Addgene's eBook Collection

    Type
    Guide
    ...Overlay Select Fluorescent Proteins 101 August 2017 | First Edition About Fluorescent Proteins 101 ... this eBook, you’ll find tips for choosing a fluorescent protein; information on FRET, biosensors, and...
  16. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...lentiviral packaging methods . The three plasmids described above (envelope, packaging, and transfer) are ...resistance is not the only type of selectable marker. Fluorescent reporters, such as GFP, are another common selection...marker. Instead of selection by an antibiotic, fluorescence-activated cell sorting (FACS) is used to sort...
  17. Plan Your Experiment

    Type
    Guide
    ...validate your genetic edit. Figure 1: Flow chart describing the general framework of a CRISPR experiment.... mRNA and Proteins In addition to the methods described above, you can also directly deliver mature mRNA...endosomal approach. Similar to the mRNA method described above, this method is also transient, as the RNPs...
  18. Lentiviral Vector Guide

    Type
    Guide
    ...resistance is not the only type of selectable marker. Fluorescent reporters, such as GFP, are another common selection...marker. Instead of selection by an antibiotic, fluorescence-activated cell sorting (FACS) is used to sort..., M., Sutherland, H., Saenz, D., Bickmore, W., Poeschla, E., & Bushman, F. D. (2007). Role of PSIP1/LEDGF...
Showing: 681 - 700 of 705 results