Skip to main content

We narrowed to 16 results for: ESC;

Showing: 1 - 16 of 16 results
  1. Chemogenetics Guide

    Type
    Guide
    ...option. Coupling brighter bioluminescent modules, such as luciferase-fluorescent protein fusions, to more-sensitive... routes. Image courtesy of Ute Hochgeschwender . Table 3. Descriptions of LMOs and their activity in neurons... alternative DREADD ligands. Compound 21, Deschloroclozapine (DCZ), Perlapine, and Olanzapine have all...bidirectional control of neuronal activity. Table 1. Descriptions of DREADDs and their activity in neurons DREADD...their effect, and outcome in neurons. Table 2. Descriptions of PSAMs and their activity in neurons PSAM ... PSAM plasmids ! LMOs Luminopsins (LMOs), or luminescent opsins, are opto-chemogenetic fusion proteins...Barter JW, Rossi MA, Augustine GJ, Yin HH, Hochgeschwender U (2016). Luminopsins integrate opto- and chemogenetics...
  2. Antibody Guide

    Type
    Guide
    ... is described in more detail in the Multiplex Assays section below. The following table describes the ...performs a chemiluminescent reaction in the presence of several different substrates. The luminescence produced...wells) by fluorescence activated cell sorting (FACS). Figure 7: Flow cytometry uses fluorescently-labeled...of B cells isolated from animals immunized as described above are used to create hybridomas, which produce...each antibody has two binding sites. Isotype Description Configuration and Valency Subclasses IgA Prevalent... to visualize protein location. Includes: Immunofluorescence (IF) Immunohistochemistry (IHC) Immunocytochemistry...primary antibody for your protein of interest, as described in the IP section above. Reverse the crosslink...
  3. Molecular Biology Reference

    Type
    Guide
    ...recognizes the different fluorescent labels. The machine detects which fluorescently labeled nucleotide is...some common plasmid elements: Plasmid Element Description Origin of Replication ( ori ) DNA sequence which...the control of a non-bacterial promoter) or a fluorescent protein (that can be used to select or sort the...commercial lab strains of E. coli used today are descended from two individual isolates, the K-12 strain ...relies on the random incorporation of modified, fluorescently tagged bases onto the growing DNA strand in ...process occurs when the polymerase incorporates a fluorescently tagged nucleotide. Because these special bases...nucleotide, the reaction is halted once the fluorescently tagged base is incorporated. Sanger sequencing...
  4. CRISPR Guide

    Type
    Guide
    ...catalytically inactive dCas9 to a fluorescent marker like green fluorescent protein (GFP), creating a customizable... sequences using a fluorescent reporter. In SHERLOCK, a quenched ssRNA fluorescent reporter is added to...have been created by directed evolution of the Escherichia coli TadA, a tRNA adenosine deaminase. Like cytosine...customizable DNA or RNA label for fluorescence microscopy. RNA aptamers, like MS2 or PP7, can also be fused...fused to the gRNA to recruit fluorescently-tagged RNA-binding proteins (RBPs). Multicolor CRISPR imaging...dCas9 and S. aureus dCas9) tagged with different fluorescent proteins or by fusing the gRNAs to orthogonal...imaging of genomic loci, as in the CRISPR-Sirius . Fluorescent CRISPR systems have been used for dynamic tracking...
  5. Optogenetics Guide

    Type
    Guide
    ...cell membrane. Microbial opsins, such as those described below, can be targeted and expressed in specific... Microbial Opsin Variants Opsin Type Variant Description Peak Response Spectra (nm) Channelrhodopsins:...dimerization. In addition to the applications described above, both LOV and Dronpa can control activity...plasmids for your next experiment. For a full description of different domains used in these plasmids, ...Glossary of Optical Switches Category Variant Description Peak Response Spectra (nm) BLUF domains bPAC ...activator FixJ in the absence of blue light. 470 Fluorescent Protein domains Dronpa based Light-inducible ...engineered from a green-to-red photoconvertible fluorescent protein 400 UVR8 domains UVR8 plant photoreceptor...
  6. Sequencing Primers

    Type
    Guide
    ..., reverse primer pBluescriptKS TCGAGGTCGACGGTATC For pBluescript vector pBluescriptSK TCTAGAACTAGTGGATC... 3′. Commonly Used Primers Primer Sequence & Description CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen...forward primer Full Primer List Primer Sequence & Description 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For...TCTAGAACTAGTGGATC For pBluescript vector pBMN 5' GCTTGGATACACGCCGC MMLV sequence, for inserts in pBMN retroviral vector...
  7. Modular Cloning Guide

    Type
    Guide
    ...MoClo kits in our collection. Kit name Type PI Description MoClo Toolkit Plant Expression Sylvestre Marillonnet...PhytoBrick parts. MoBiFC - Modular Bimolecular Fluorescence Complementation Toolkit Plant Expression Benjamin...Field 50 plasmids for assembling bimolecular fluorescence complementation experiments to analyze protein-protein...Volker Sieber Plasmids with control elements and fluorescent reporters to be used in combination with the ...synthetic terminators, protein purification tags and fluorescence proteins for use in E. coli for a variety of...Christopher Dupont 95 plasmids including backbones, fluorescent proteins, protein tags, and signal peptides, ...
  8. Addgene's eBook Collection

    Type
    Guide
    ...Overlay Select Fluorescent Proteins 101 August 2017 | First Edition About Fluorescent Proteins 101 ... this eBook, you’ll find tips for choosing a fluorescent protein; information on FRET, biosensors, and...
  9. Promoters

    Type
    Guide
    ...proximal promoter, and distal promoter. Below describes the specifics of these regions in eukaryotic cells...Promoters Used in Research Promoter Expression Description CMV Constitutive Strong mammalian promoter from...Promoters used in Research Promoter Expression Description T7 Constitutive but requires T7 RNA polymerase...
  10. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...lentiviral packaging methods . The three plasmids described above (envelope, packaging, and transfer) are ...resistance is not the only type of selectable marker. Fluorescent reporters, such as GFP, are another common selection...marker. Instead of selection by an antibiotic, fluorescence-activated cell sorting (FACS) is used to sort...
  11. Plan Your Experiment

    Type
    Guide
    ...validate your genetic edit. Figure 1: Flow chart describing the general framework of a CRISPR experiment.... mRNA and Proteins In addition to the methods described above, you can also directly deliver mature mRNA...endosomal approach. Similar to the mRNA method described above, this method is also transient, as the RNPs...
  12. Lentiviral Vector Guide

    Type
    Guide
    ...resistance is not the only type of selectable marker. Fluorescent reporters, such as GFP, are another common selection...marker. Instead of selection by an antibiotic, fluorescence-activated cell sorting (FACS) is used to sort..., M., Sutherland, H., Saenz, D., Bickmore, W., Poeschla, E., & Bushman, F. D. (2007). Role of PSIP1/LEDGF...
  13. Educational Resources

    Type
    Guide
    ...include: Plasmids 101 CRISPR 101 Viral Vectors 101 Fluorescent Proteins 101 Science Career Guide Videos Watch...techniques. Topics include: Genome Engineering Fluorescent Proteins CRISPR Viral Vectors Plasmid Technology...
  14. Science Guides

    Type
    Guide
    ...Collection of guides that describe how popular scientific techniques work...
  15. Cloning

    Type
    Guide
    ...been made with different promoters, tags and fluorescent proteins. Thus, you can clone your gene of interest...
Showing: 1 - 16 of 16 results