We narrowed to 767 results for: SCR

...using previously published antibodies, check the manuscript and supplementary figures for validation data...

... Integrative vector assembly of up to three transcription units in the oleaginous yeast Y. lipolytica ...

...cloning process as it can be used in blue–white screening . Adenoviral Vector ID Purpose pAdx-CMV-LacZ 73345...

...name for ordering information. ID Name Promoter Description Category PI 157970 pTR-UF11 chimeric CMV/Chicken...

...protocols, titering methods, and quality control are described below. AAV Production AAV distributed by Addgene...

...proteins fused with linkers of varying lengths. Description Article ECFP-EYFP FRET standards, fusion proteins...

...vector for investigating regions controlling transcription See our Luciferase collection of plasmid backbones...

...individual plasmid webpages. These plasmids are described in Portales-Casamar et al., 2010 . List of Pleiades...

...expression. The Allen Institute for Brain Sciences has screened thousands of enhancers for specificity and brightness...

...fluorescence to reach half its maximal value. Structure describes the oligomeric state of the protein. Many FPs ...

... Gavira-O'Neill CE, et al. 2020. Development, Screening, and Validation of Camelid-Derived Nanobodies ...

...plasmid. Library screens can be divided into two types: positive screens and negative screens. Both types ...mechanism Negative screens are a little trickier than positive screens. In a negative screen, the goal is to...Library Screening Resources Pooled libraries represent a powerful tool for forward genetic screening or identifying...sequences, screening certain types of proteins (such as cell surface receptors or transcription factors)...mutant cells that are then screened for a phenotype of interest. Screening experiments using a pooled ... also useful for loss-of-function screens, gain-of-function screens, enhancer/promoter mapping, and variant...ensure adequate representation of every guide Screening Screening libraries (non-CRISPR) can be used for many...

...initiation of transcription, whereas transcription factors promote the initiation of transcription. The binding... eukaryotic promoters, including transcription and the transcription complex. Educational...that is transcribed by the RNA polymerase. Figure 1: Simplified promoter region during transcription. Created... site for the RNA polymerase and transcription factors. Transcription factors are proteins which recruit...TSS = transcription start site. Created with BioRender.com. Operons Although bacterial transcription is ...normally transcribed until a repressor/corepressor binds to the operator preventing transcription. The trp...eukaryotic promoter structure. TF = transcription factor; TSS = transcription start site. Created with BioRender.com...

...integration of donor DNA. Genome-Wide Screens Using CRISPR In a genetic screen, a population of cells with mutations...Targeting dCas9 to transcription start sites is sufficient to repress transcription by blocking initiation..., G. M. (2013). CAS9 transcriptional activators for target specificity screening and paired nickases for...in your lab, from knockouts to pooled library screening. Science...CRISPR Basics Small Edits Large Edits Genome-Wide Screening Cas9 Fusion Tools Cas9 Alternatives Resources ...approaches like zinc finger nucleases (ZFNs) or transcription-activator-like effector nucleases (TALENs) required...technologies, making CRISPR perfect for genome-wide screens. This guide will provide a basic understanding ...

... interfere with transcription elongation. CRISPR Activation : Target the transcription start site. CRISPRa...fused to transcriptional activators that need to be within a given range of the transcription start site...validate your genetic edit. Figure 1: Flow chart describing the general framework of a CRISPR experiment....Prime editor (Cas9 nickase fused to reverse transcriptase (RT)) Can edit within a wider window than most...genome sequence dCas9 or dCas9 fusion with transcriptional repressor (such as dCas9-KRAB) dCas9-KRAB can...modifying the genome sequence dCas9 fusion with transcriptional activator (such as dCas9-VP64) Many different... interest, where the Cas9 protein can block transcription from ever initiating. gRNAs targeting regions...

...LTR after one round of reverse transcription, inhibiting transcription of the full-length virus after ...in-stock lentiviral preps . CRISPR Genomic Screens Genome-wide screens are an efficient way to determine what... made of RNA. This retroviral RNA is reverse transcribed into DNA before being integrated in the genome...encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus, the cDNA that will be integrated...that lentiviruses most often integrate into transcriptionally active regions, regions recently involved ...does not explain the lentiviral preference for transcribed genes. Studies comparing the lentivirus HIV and... genetic mutants for various phenotypes. These screens involve hundreds to even thousands of target genes...

...generate two-part transcription factors, where Cry2 and CIB1 are fused to a transcriptional activation domain...cell membrane. Microbial opsins, such as those described below, can be targeted and expressed in specific...Channelrhodopsins from Chlamydomonas reinhardtii Name Description Peak excitation λ (nm) ChR2 Widely used light-gated...variant of CrChR2 590 Other Channelrhodopsins Name Description Peak excitation λ (nm) VChR1 Red-shifted channelrhodopsin... from Wobblia lunata 490 Anion Channels Name Description Peak excitation λ (nm) GtACR Chloride-conducting...photocurrent amplitude 517 Halorhodopsins Name Description Peak excitation λ (nm) Jaws Red-shifted, light-driven...membrane targeting 589 Archaerhodopsins Name Description Peak excitation λ (nm) Arch Light-activated outward...

... made of RNA. This retroviral RNA is reverse transcribed into DNA before being integrated in the genome...encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus, the cDNA that will be integrated...lentiviral packaging methods . The three plasmids described above (envelope, packaging, and transfer) are ...genome. Gamma-retroviral vectors tend to prefer transcription start sites, such as promoters and enhancers... into the 5' LTR after one round of reverse transcription. After incorporation into a host cell, this ...this deletion prevents further transcription of the full-length virus. The potential for oncogenesis is largely...Li, Y., Crise, B., & Burgess, S. M. (2003). Transcription start regions in the human genome are favored...

...promoter Reverse pBluescript KS TCGAGGTCGACGGTATC For pBluescript vector Forward pBluescript SK TCTAGAACTAGTGGATC...promoter Reverse pBluescriptKS TCGAGGTCGACGGTATC For pBluescript vector Forward pBluescriptSK TCTAGAACTAGTGGATC... Sequencing Primers Name Sequence (5' to 3') Description Direction BGH-R TAGAAGGCACAGTCGAGG Bovine growth...TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' end of MCS in pGEX vectors... Sequencing Primers Name Sequence (5' to 3') Description Direction 3'AOX1 GCAAATGGCATTCTGACATCC For Pichia...recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC CYC1 transcriptioin termination signal/td> Reverse DsRed1-C AGCTGGACATCACCTCCCACAACG...TCTAGAACTAGTGGATC For pBluescript vector Reverse pBMN 5' GCTTGGATACACGCCGC MMLV sequence, for inserts in pBMN retroviral...

...Promoter Region Drives transcription of the insert. The promoter recruits transcriptional machinery and can...that proteins are translated from RNA, which is transcribed from DNA. The Genetic Code The genetic code is...DNA is converted to RNA in a process called transcription. RNA uses the same nucleotide bases as DNA, ...fact, most DNA is non-coding. These regions are transcribed into non-coding RNA (ncRNA) and play important...regulation. Regions that code for proteins are transcribed and processed into mature messenger RNA (mRNA...General structure of a plasmid. Plasmid Element Description Origin of Replication ( ori ) DNA sequence which... prior to use in an experiment. Plasmid Type Description Addgene Resource(s) Cloning Plasmids Used to ...