Skip to main content

We narrowed to 16 results for: SCR

Showing: 1 - 16 of 16 results
  1. Promoters

    Type
    Guide
    ...initiation of transcription, whereas transcription factors promote the initiation of transcription. The binding... eukaryotic promoters, including transcription and the transcription complex. Educational...that is transcribed by the RNA polymerase. Figure 1: Simplified promoter region during transcription. Created... site for the RNA polymerase and transcription factors. Transcription factors are proteins which recruit...TSS = transcription start site. Created with BioRender.com. Operons Although bacterial transcription is ...normally transcribed until a repressor/corepressor binds to the operator preventing transcription. The trp...eukaryotic promoter structure. TF = transcription factor; TSS = transcription start site. Created with BioRender.com...
  2. Guide to Using Pooled Libraries

    Type
    Guide
    ...Negative Screen Negative screens are a little trickier than positive screens. In a negative screen, the goal...plasmid. Library screens can be divided into two types: positive screens and negative screens (Figure 2). ...Types of Screens Resources Pooled libraries represent a powerful tool for forward genetic screening, or identifying...BioRender.com. Types of Pooled Library Screens In pooled library screens, cells are infected at a very low ... of the selection mechanism Positive Screen In a positive screen, the goal is to identify those cells ...been depleted by selection. In a CRISPR screen, negative screens are often used to identify genes that ...Knockout Screening Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional Screens New...
  3. CRISPR Guide

    Type
    Guide
    ...integration of donor DNA. Genome-Wide Screens Using CRISPR In a genetic screen, a population of cells with mutations...Targeting dCas9 to transcription start sites is sufficient to repress transcription by blocking initiation..., G. M. (2013). CAS9 transcriptional activators for target specificity screening and paired nickases for...in your lab, from knockouts to pooled library screening. Science...CRISPR Basics Small Edits Large Edits Genome-Wide Screening Cas9 Fusion Tools Cas9 Alternatives Resources ...approaches like zinc finger nucleases (ZFNs) or transcription-activator-like effector nucleases (TALENs) required...technologies, making CRISPR perfect for genome-wide screens. This guide will provide a basic understanding ...
  4. Plan Your Experiment

    Type
    Guide
    ... interfere with transcription elongation. CRISPR Activation : Target the transcription start site. CRISPRa...fused to transcriptional activators that need to be within a given range of the transcription start site...validate your genetic edit. Figure 1: Flow chart describing the general framework of a CRISPR experiment....Prime editor (Cas9 nickase fused to reverse transcriptase (RT)) Can edit within a wider window than most...genome sequence dCas9 or dCas9 fusion with transcriptional repressor (such as dCas9-KRAB) dCas9-KRAB can...modifying the genome sequence dCas9 fusion with transcriptional activator (such as dCas9-VP64) Many different... interest, where the Cas9 protein can block transcription from ever initiating. gRNAs targeting regions...
  5. Lentiviral Vector Guide

    Type
    Guide
    ...LTR after one round of reverse transcription, inhibiting transcription of the full-length virus after ...in-stock lentiviral preps . CRISPR Genomic Screens Genome-wide screens are an efficient way to determine what... made of RNA. This retroviral RNA is reverse transcribed into DNA before being integrated in the genome...encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus, the cDNA that will be integrated...that lentiviruses most often integrate into transcriptionally active regions, regions recently involved ...does not explain the lentiviral preference for transcribed genes. Studies comparing the lentivirus HIV and... genetic mutants for various phenotypes. These screens involve hundreds to even thousands of target genes...
  6. Gamma-Retroviral Vector Guide

    Type
    Guide
    ... made of RNA. This retroviral RNA is reverse transcribed into DNA before being integrated in the genome...encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus, the cDNA that will be integrated...lentiviral packaging methods . The three plasmids described above (envelope, packaging, and transfer) are ...genome. Gamma-retroviral vectors tend to prefer transcription start sites, such as promoters and enhancers... into the 5' LTR after one round of reverse transcription. After incorporation into a host cell, this ...this deletion prevents further transcription of the full-length virus. The potential for oncogenesis is largely...Li, Y., Crise, B., & Burgess, S. M. (2003). Transcription start regions in the human genome are favored...
  7. Optogenetics Guide

    Type
    Guide
    ...synthetic two-part transcription factors, where Cry2 and CIB1 are fused to a transcriptional activation domain...cell membrane. Microbial opsins, such as those described below, can be targeted and expressed in specific... Microbial Opsin Variants Opsin Type Variant Description Peak Response Spectra (nm) Channelrhodopsins:...protein activation, membrane localization, and transcriptional activation. In the widely used Cry2-CIB1 system... binding domain, allowing light to activate transcription. Phytochromes and light oxygen voltage (LOV)...dimerization. In addition to the applications described above, both LOV and Dronpa can control activity...Collection for your next experiment. For a full description of different domains used in these plasmids, ...
  8. Sequencing Primers

    Type
    Guide
    ...promoter Reverse pBluescript KS TCGAGGTCGACGGTATC For pBluescript vector Forward pBluescript SK TCTAGAACTAGTGGATC...promoter Reverse pBluescriptKS TCGAGGTCGACGGTATC For pBluescript vector Forward pBluescriptSK TCTAGAACTAGTGGATC... Sequencing Primers Name Sequence (5' to 3') Description Direction BGH-R TAGAAGGCACAGTCGAGG Bovine growth...TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' end of MCS in pGEX vectors... Sequencing Primers Name Sequence (5' to 3') Description Direction 3'AOX1 GCAAATGGCATTCTGACATCC For Pichia...recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC CYC1 transcriptioin termination signal/td> Reverse DsRed1-C AGCTGGACATCACCTCCCACAACG...TCTAGAACTAGTGGATC For pBluescript vector Reverse pBMN 5' GCTTGGATACACGCCGC MMLV sequence, for inserts in pBMN retroviral...
  9. Molecular Biology Reference

    Type
    Guide
    ...Promoter Region Drives transcription of the insert. The promoter recruits transcriptional machinery and can...that proteins are translated from RNA, which is transcribed from DNA. The Genetic Code The genetic code is...DNA is converted to RNA in a process called transcription. RNA uses the same nucleotide bases as DNA, ...fact, most DNA is non-coding. These regions are transcribed into non-coding RNA (ncRNA) and play important...regulation. Regions that code for proteins are transcribed and processed into mature messenger RNA (mRNA...General structure of a plasmid. Plasmid Element Description Origin of Replication ( ori ) DNA sequence which... prior to use in an experiment. Plasmid Type Description Addgene Resource(s) Cloning Plasmids Used to ...
  10. Modular Cloning Guide

    Type
    Guide
    ...nucleases (TALENs) and transcription factors (TALE-TFs) for genome editing and transcription modulation applications...assembled into a Level 1 vector creating a single transcriptional unit (for example, a promoter, a 5' UTR, a ...MoClo kits in our collection. Kit name Type PI Description MoClo Toolkit Plant Expression Sylvestre Marillonnet...components to create plasmids with multiple transcriptional units. MultiGreen Kit Plant Expression Wayne... Sylvestre Marillonnet Plasmids to generate transcription units for protein secretion in yeasts S. cerevisiae...including overexpression plasmids with up to eight transcription units. Yarrowia lipolytica Golden Gate tool ...plasmids to assemble and integrate up to three transcription units in the oleaginous yeast Y. lipolytica ...
  11. Adenovirus Guide

    Type
    Guide
    ... length and contain multiple heavily-spliced transcripts flanked by two inverted terminal repeats (ITRs...and late (L1, L2, L3, L4, L5) regions. Early transcripts are expressed shortly after the virus enters ...replication and host cell manipulation. Late transcripts are expressed after DNA replication starts and...produced by replacing the early and late adenoviral transcript regions between the two ITRs with the transgenes...removing the E1 region, containing the E1A and E1B transcripts, and the E3 region from the viral genome. This...plasmid E2A, E2B, E3, E4 in trans Adenoviral early transcript regions involved in viral DNA replication and.... L1, L2, L3, L4, L5 in trans Adenoviral late transcript regions that encode for structural capsid proteins...
  12. Antibody Guide

    Type
    Guide
    ... is described in more detail in the Multiplex Assays section below. The following table describes the ...of B cells isolated from animals immunized as described above are used to create hybridomas, which produce...each antibody has two binding sites. Isotype Description Configuration and Valency Subclasses IgA Prevalent...primary antibody for your protein of interest, as described in the IP section above. Reverse the crosslink...validation can be done using methods such as transcriptomics or proteomics. This approach is often appropriate...
  13. Chemogenetics Guide

    Type
    Guide
    ...bidirectional control of neuronal activity. Table 1: Descriptions of DREADDs and their activity in neurons DREADD...their effect, and outcome in neurons. Table 2: Descriptions of PSAMs and their activity in neurons PSAM ...Image courtesy of Ute Hochgeschwender . Table 3: Descriptions of LMOs and their activity in neurons LMO Luciferase...
  14. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...WPRE in cis Woodchuck hepatitis virus post‐transcriptional regulatory element; stimulates the expression... of RNA and RNA translation, and promotes RNA transcript longevity. Located between WPRE and 3'ITR. Not...
  15. Science Guides

    Type
    Guide
    ...Collection of guides that describe how popular scientific techniques work...
  16. Addgene's eBook Collection

    Type
    Guide
    ...and how to use pooled libraries in genome-wide screens. Close About Overlay Select Fluorescent Proteins...
Showing: 1 - 16 of 16 results