Skip to main content

We narrowed to 729 results for: ACE;

Showing: 61 - 80 of 729 results
  1. New Optogenetic Tools for Cytoskeleton and Membrane Control

    Type
    Blog Post
    ...Systems: The Rho-Family GTPase Signaling Toolbox. ACS Synthetic Biology, 11(1), 515–521. https://doi.org...and study a protein’s function at a very specific place and time. Future studies with these CIB1-Rabs in...
  2. Hot Biosensors 2022: Year-End Roundup

    Type
    Blog Post
    ...through Structure-Guided and Genome Mining Strategies. ACS Sens. 2022 May 27;7(5):1336-1346. doi: 10.1021/acssensors...sensor Ace2N and additional GCaMP6 constructs: pAAV-CAG-dLight1.2 (AAV1) pGP-AAV-syn-FLEX-Ace2N-4AA-mNeon-ST...fluorescence unit fused with TRansmembrane region-to-IntrAcellular loop linkers” (MTRIA for short), where a fluorescent...inserting a circularly-permuted GFP into an intracellular loop of various G-protein-coupled receptors....fluorescent sensor for real-time measurement of extracellular oxytocin dynamics in the brain. Nat Methods....  Find B-gTEMP plasmids here!   Lu K, et al. Intracellular Heat Transfer and Thermal Property Revealed ...
  3. Antibodies 101: The Basics of Western Blotting

    Type
    Blog Post
    ...Pillai-Kastoori L, Heaton S, Shiflett SD, Roberts AC, Solache A, Schutz-Geschwender AR (2019) Antibody...sample migrate through the stacking gel at the same pace and enter the resolving gel at the same time where...post-translational modifications such as phosphorylation, acetylation, methylation and ubiquitination. For example,...
  4. Genetic Code Expansion

    Type
    Collection
    ... Nε-acetyl-L-lysine Bacterial TAG David Liu 104071 pTECH-MmAcK3RS(IPYE) AcK3RS M. mazei Nε-acetyl-L-lysine...thermophila acetyl-lysine Mammalian Tao Liu 164081 pCMV-MfPylRS (human-opti) PylRS M. flavescens acetyl-lysine...thermophila acetyl-lysine Mammalian Tao Liu 164196 pCMV-MfBulKRS (human-opti) BulKRS M. flavescens acetyl-lysine...tyrS gene knocked out, tyrTV gene replaced by tolC, and tyrU gene replaced by GentR). Expresses archaeal ...tyrTV gene replaced by tRNA variant that suppress the TAG nonsense codon, and tyrU gene replaced by tRNA ...tyrS gene knocked out, tyrTV gene replaced by tolC, and tyrU gene replaced by GentR) and release factor 1...expressed from a plasmid containing a UAG codon at the place where the new amino acid would be incorporated. ...
  5. CRISPR Guide

    Type
    Collection
    ...The target is present immediately adjacent to a P rotospacer A djacent M otif (PAM) The PAM sequence (NGG...codons that make up a gene PAM P rotospacer A djacent M otif; Sequence adjacent to the target sequence that...referred to as CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeat) technologies. Before...for Cas-binding and a user-defined ∼20-nucleotide spacer that defines the genomic target to be modified....through interactions between the gRNA scaffold and surface-exposed positively-charged grooves on Cas9. gRNA... an active, DNA-binding configuration, with the spacer region of the gRNA left free to interact with the...Cas9 will only cleave a given locus if the gRNA spacer sequence shares sufficient homology with the target...
  6. New England Biolabs Cell-Imaging Plasmid Collection

    Type
    Collection
    ... cell surface localization 101131 pACP-GPI Control Plasmid ACP/MCP-tag Control for cell surface localization...used in live or fixed cells, and for internal or surface proteins Single constructs are compatible with ...agents) ACP- and MCP-tags are used exclusively for surface proteins and use enzymatic binding to attach substrate...are particularly well suited for labeling cell-surface proteins, and are useful for labeling secreted ...pSNAPf-ADRβ2 Control Plasmid SNAP-tag Control for cell surface localization 101136 pCLIP-tag (m) Vector CLIP-tag...pCLIPf-NK1R Control Plasmid CLIP-tag Control for cell surface localization 101127 pMCP-tag (m) Vector ACP/MCP-tag...pACP-ADRβ2 Control Plasmid ACP/MCP-tag Control for cell surface localization Supplemental Information SNAP and ...
  7. COVID-19 Resources

    Type
    Collection
    ...Bosch et al., 2008). TACE plasmids - (ADAM17) a metalloprotease that cleaves hACE2, potentially increasing...receptor, Angiotensin Converting Enzyme 2 (ACE2). Another key step is the priming of the S protein...having a key role in coronavirus infection, such as ACE2 and TMPRSS2, which are involved in the entry of ...Description Industry PI Additional Addgene resources ACE2 plasmids - Host cell receptor mediating the entry...class I fusion protein upstream of rather than adjacent to the fusion peptide . Journal of virology, 82...& Pöhlmann, S. (2014). TMPRSS2 and ADAM17 cleave ACE2 differentially and only proteolysis by TMPRSS2 augments...Pöhlmann, S. (2020). SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven...
  8. Validated gRNA Sequences

    Type
    Collection
    ...lC.GA4a B. oleracea GTTGAGAGGGGAGCCGGTGA 68256 cut S. pyogenes 26616834 Patron lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG...GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N. meningitidis 23940360 Thomson Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48651 cut N....N. meningitidis 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48652 cut N. meningitidis...meningitidis 24076762 Church Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48653 cut S. thermophilus 24076762 Church...Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48654 cut S. thermophilus 24076762 Church Protospacer...TACCATCTCAAGCTTGTTGA 48655 cut T. denticola 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48656 cut T....
  9. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ... Anti-Pan-Neurofascin (extracellular) [A12/18R] Pan-Neurofascin (extracellular) Rat Mouse IgG2a 177439...Anti-Kv1.4 K+ channel (extracellular) [L71/5R] Kv1.4 K+ channel (extracellular) Rat Mouse IgG2a 177489...Mouse IgG2a 177564 Anti-ADAM22 (extracellular) [N57/2R] ADAM22 (extracellular) Mouse Mouse IgG2a 177565 Anti-GluN2B...Anti-Kv1.4 K+ channel (extracellular) [L71/22] Kv1.4 K+ channel (extracellular) Rat Mouse IgG2a 190292...-Neurofascin (extracellular) scFv [A12/18] A12/18 scFv 2t Pan-Neurofascin (extracellular) Rat Mouse 190486...Kv1.4 K+ channel (extracellular) scFv [L71/5] L71/5 scFv Kv1.4 K+ channel (extracellular) Rat Mouse 190518... Mouse 190537 LRP4 (extracellular) scFv [N207/27] N207/27 scFv LRP4 (extracellular) Mouse Mouse 190538...
  10. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...ATAACTTCGTATAgcatacatTATACGAAGTTAT 13 bp inverted repeats + 8 bp spacer (34 bp) lox2272, lox5171, lox511, loxN, lox66/lox71...TAACTTTAAATAATgccaATTATTTAAAGTTA 14 bp inverted repeats + 4 bp spacer (32 bp) Currently, only the canonical rox site ...GAAGTTCCTATTCCGAAGTTCCTATTCtctagaaaGTATAGGAACTTC 13 bp inverted repeats + 8 bp spacer (48 bp or 34 bp) F3, F5, FRT14, FRT15 minimal FRT...split into inactive N- and C-terminal fragments and placed under the control of different promoters. Expression...often called a "lox-STOP-lox" or "LSL" cassette) placed upstream of a gene of interest will prevent gene...an exogenous donor cassette, the donor cassette replaces the target site cassette in a double-crossover...
  11. Distribution to Industry

    Type
    Collection
    ...account, you can place orders through our website. Please note that all orders must be placed online through...HaloTag Fusions from Promega COVID-19 SARS-COV-2, ACE2, and CRISPR tools Fluorescent Proteins from the ... account has been verified, you will be able to place your order on our website. Placing an Order: After...Center . The MTA Process: Once your order has been placed on our website, Addgene will email you a link to...
  12. Antibody Guide

    Type
    Collection
    ...suspended in the original media or isolated and placed in a buffer. Antibody Structure Figure 1: Structure...of 4 IgA1; IgA2 IgD Coexpressed with IgM on the surface of most immature B cells; function is unknown Monomer...by a capture antibody (sandwich). Block unused surface-binding sites in the wells with a blocking protein...sandwich ELISA, a capture antibody, bound to a surface, is used to capture the protein of interest and...In IHC, tissue sections are assayed and the extracellular matrix remains intact. The signaling molecule...enzyme. In ICC, cells have most or all of their extracellular matrix removed. Again, the signaling molecule...cells. Cells, with labeled antibodies bound to surface receptors, are “flowed” through a flow cytometer...
  13. CRISPR References and Information

    Type
    Collection
    ...2014) (Link opens in a new window) . protoSpaceJAM protoSpaceJAM is an all-around platform for CRISPR ...Bacteria: pCas9 new spacer cloning pCas9 PDF, 129 KB Marraffini Bacteria: pCRISPR new spacer cloning pCRISPR...Juan L. Mateo (Link opens in a new window) Labs. ACEofBASEs (Link opens in a new window) Identification of...
  14. Zinc Finger Consortium: Nuclease Expression Vectors

    Type
    Collection
    ...for expression of a ZFN targeted to a site with a spacer of 7 bps and harboring a “+” heterodimeric FokI...for expression of a ZFN targeted to a site with a spacer of 7 bps and harboring a “-” heterodimeric FokI...expression of a ZFN targeted to a site with a 5 or 6 bp spacer and “+” KKR heterodimeric FokI domain. ( Doyon ...expression of a ZFN targeted to a site with a 5 or 6 bp spacer and “-” ELD heterodimeric FokI domain. ( Doyon ...
  15. Bacterial Expression Systems

    Type
    Collection
    ...extorquens Julia Vorholt 84693 pMyNT-kan Acetamidase promoter Acetamide Escherichia coli , Mycobacterium smegmatis...smegmatis Matthias Wilmanns 84692 pMyC-kan Acetamidase promoter Acetamide Escherichia coli , Mycobacterium smegmatis... direct recombinant proteins to the periplasmic space between the inner and outer membranes. Targeting...
  16. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...187,535 Advanced Catalogue of Epigenetic Regulators (ACER) 226117 Knockout Human Lu 3rd 10 8,205 Bassik Human...–6 67,366 (Set A) 67,194 (Set B) Cas13a/C2c2 Protospacer flanking site (PFS) Library 79153 Knockout E....E. coli Zhang N/A N/A N/A - The protospacers contained in the library represent all 4096 (4 6 ) combinations...Knockout Human J. Chen 3rd 10 4,530 Murine Cell Surface Protein Knockout (McspKO) Library 200445 Knockout...Sabatini and Lander 3rd 10 Varies FNLCR CRISPRa Cell Surface Libraries 207471 1000000228 Activation Human Chari...
  17. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...Find prime editor plasmids for (search and replace) genome editing....CRISPR Blog Posts Prime editing is a “search and replace” gene editing method in which a reverse transcriptase...with a typical gRNA, the pegRNA is designed with a spacer that binds to a specific genomic DNA locus and ... reverse transcription. The edited DNA strand displaces the unedited 5’ flap and the resulting heteroduplex...
  18. AAV Molecular Tools

    Type
    Collection
    ...Ablation Genome Engineering Labeling Overexpression Tracers Tetracycline Transactivators and Inducible Tools...mutation 1 Tsuneya Ikezu Anterograde Transsynaptic Tracers These AAV encode tools that can be used to map ...across synapses. Also see Monosynaptic Neuronal Tracers available at Addgene. ID Name Expression System...-driven, constitutive Anterograde transsynaptic tracer protein to express in presynaptic glutamatergic...
  19. Promega Plasmid Collection

    Type
    Collection
    ...NanoLuc fusions are useful for both intracellular and extracellular applications where you want minimal...compounds is measured by competitive displacement of a NanoBRET tracer, reversibly bound to a NanoLuc luciferase-fusion...
Showing: 61 - 80 of 729 results