Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 741 results for: REV

Showing: 61 - 80 of 741 results

  1. Zhang Lab CRISPR Page

    Type
    Collection
    ... plasmid can be digested using SapI, which will reveal sticky ends to enable the rapid ligation of annealed...FA, Hsu PD, Lin CY, Gootenberg JS, Konermann S, Trevino AE, Scott DA, Inoue A, Matoba S, Zhang Y, Zhang...CRISPR-Cas9 complex. Konermann S*, Brigham MD*, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib...

  2. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...red fluorescent protein tagging vectors for S. cerevisiae. PLoS One, 8 (7):e67902. https://doi.org/10.1371... fluorescent protein tagging in Saccharomyces cerevisiae. Yeast, 21 (8):661-70. https://doi.org/10.1002...selection markers for engineering in Saccharomyces cerevisiae. Microb Cell Fact, 12 :96. https://doi.org/10.1186...24161108 (Link opens in a new window) Content last reviewed: 12 August 2025...

  3. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ... replication. 5’LTR 5’ long terminal repeat. RRE Rev response element. A.3 Related Products The following... RNA polymerase III. Note that these were the prevailing guidelines when the pLKO.1 vector was created...CCGG—21bp sense—CTCGAG—21bp antisense—TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA—21bp sense—CTCGAG...AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA AATGCCTACGTTAAGCTATAC...the sticky ends of EcoRI and AgeI. Forward and reverse oligos are annealed and ligated into the pLKO.1...concentration of 20 μM, then mix: 5 μL Forward oligo 5 μL Reverse oligo 5 μL 10x NEB buffer 2 35 μL ddH 2 O Incubate...TRC Cloning Vector The following steps were the prevailing guidelines when the pLKO.1 vector was created...

  4. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ... derived from P1 E. coli bacteriophage and S. cerevisiae , respectively. Other tyrosine recombinases include... the region of DNA between the target sites is reversed. B) If the target sites are on the same DNA strand...cassette) placed upstream of a gene of interest will prevent gene expression in the absence of Cre. In the presence...Tracing CRISPR Plasmids and Resources Content last reviewed on 31 July 2025. Do you have suggestions for other...

  5. Antibody Guide

    Type
    Collection
    ...Description Configuration and Valency Subclasses IgA Prevalent antibody in secretions (e.g. tears, saliva, mucus... in the cell, and sample processing can hide or reveal epitopes on an antigen. Monoclonal antibodies only...block the membrane to remove excess antibody and prevent unwanted binding. Incubate the membrane with a ...should be run with: a positive control, a sample previously verified to contain your protein of interest ...interest, as described in the IP section above. Reverse the crosslink, isolate DNA, and perform downstream...

  6. Genetic Code Expansion

    Type
    Collection
    ...pAB228v TrpRS S. cerevisiae Bacterial Ahmed Badran 209745 pAB228v6 TrpRS S. cerevisiae Bacterial Ahmed ...things to consider. If you are working off of a previously established protocol, make sure to match the ..., ncAA concentration, and the cell lines used previously. Remember that the orthogonal pairs of synthetase...209746 pAMC070n1a12 ScTrpRS, Lum1PylRS, MmPylRS S. cerevisiae, Lum1, M. mazei Bacterial Ahmed Badran 212122...

  7. Microbiology Resources

    Type
    Collection
    ... S. cerevisiae - Dueber Lab Yeast Prototrophy : Restoration of prototrophy in common S. cerevisiae lab...color. External Resources European Saccharomyces Cerevisiae Archive for Functional Analysis (EUROSCARF) (...

  8. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ... Lgi1 Mouse Mouse IgG2a 177528 Anti-Brevican [N294A/10R] Brevican Rat Mouse IgG2a 177529 Anti-GluN1 [N308...ARHGAP4 Mouse Mouse IgG2a 190309 Anti-Brevican [N294A/6] Brevican Rat Mouse IgG2a 190311 Anti-NSD1 [N312...Synaptotagmin-7 Mouse Mouse IgG2a 220429 Brevican [N294A/10R-2b] Brevican Rat Mouse IgG2a 220430 BAF53b [N332B...external) Human Mouse 206772 Brevican scFv [N294A/6] N294A/6 scFv Brevican Rat Mouse 206773 GluN3A/NR3A...

  9. Plan Your Experiment

    Type
    Collection
    ...RNA (pegRNA) Prime editor (Cas9 nickase fused to reverse transcriptase (RT)) Can edit within a wider window...the gRNA vector you have chosen, so it is best to review the protocol associated with the specific plasmid...doi.org/10.1038/nbt.3081 PMID: 25357182 Content last reviewed on 11 July 2025....

  10. Mammalian RNAi Tools

    Type
    Collection
    ...Similarities and differences . Advanced Drug Delivery Reviews, 61 (9), 746–759. PubMed (Link opens in a new window..., Zhang, J., & Feng, L. (2023). A comprehensive review of small interfering RNAs (siRNAs): mechanism, ...

  11. CRISPR Plasmids and Resources

    Type
    Collection
    ...modified from a bacterial immune system to a revolutionary tool for genome engineering. CRISPR Topic Page...breaks. Prime Edit Cas nickase enzymes fused to reverse transcriptase install new genetic information into...

  12. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...critical for developing therapeutic strategies to prevent viral spread. As a Biosafety Level 3 (BSL-3) agent... Plasmid Collection Return to top Content last reviewed on 01 October 2025. Do you have suggestions for...

  13. Recombinases AAV Preps

    Type
    Collection
    ... PI 140135 pAAV-EF1a-iCreV EF1a none 1, PHPeB Hongkui Zeng 140136 pAAV-EF1a-iDreV EF1a none 1, PHPeB Hongkui...

  14. Antibody Production

    Type
    Collection
    ...Usage” and “Delivery” conditions, so we recommend reviewing the specific antibody webpage for further information...the experiment is performed in parallel with a previous lot of recombinant antibody or the hybridoma-derived...

  15. Viral Vector Guides and Plasmids

    Type
    Collection
    ...Specific genes have been mutated or deleted to prevent uncontrolled viral replication, and the required...Topics Page Viral Vectors 101 eBook Content last reviewed: 5 August 2025...

  16. Retrovirus Plasmids

    Type
    Collection
    ...viral genome encoded on RNA. The genome includes a reverse transcriptase and an integrase to insert the viral...101 eBook Biosafety Resource Guide Content last reviewed: 23 October 2025 Do you have suggestions for other...

  17. Promega Plasmid Collection

    Type
    Collection
    ...competitive displacement of a NanoBRET tracer, reversibly bound to a NanoLuc luciferase-fusion protein ...NanoBRET® are Promega trademarks. Content last reviewed on: 15 July 2025...

  18. Sequencing Primers

    Type
    Guide
    ...cell virus Forward MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus Reverse MT1-F GCTGTCCTCTAAGCGTCACC...tdTomato Forward tdTomato-Rev TCTTTGATGACGGCCATGT 5' end of tdTomato Reverse Tet-R GGCGAGTTTACGGGTTGTTA...' end of DsRed1 Reverse EBV Reverse GTGGTTTGTCCAAACTCATC SV40 polyA terminator Reverse Ecdysone Forward... pGP704 vector Reverse pHybLex Reverse GAGTCACTTTAAAATTTGTATACAC ADH terminator Reverse pLTet-F ACTGAGCACATCAGCAGGAC...TGTAAAACGACGGCCAGT In lacZ gene Forward M13 Reverse CAGGAAACAGCTATGAC In lacZ gene Reverse M13/pUC Forward CCCAGTCACGACGTTGTAAAACG...lacZ gene Foward M13/pUC Reverse AGCGGATAACAATTTCACACAGG In lacZ gene Reverse MSCV Forward CCCTTGAACCTCCTCGTTCGACC...virus Forward MSCV Reverse CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus Reverse pBABE 5' CTTTATCCAGCCCTCAC...

  19. COVID-19 Resources

    Type
    Collection
    ...-CoV-2 main protease (Mpro) activity reporters Reverse transcriptase, protease, and polymerase constructs...33277466 (Link opens in a new window) Content last reviewed on 26 September 2025. Do you have suggestions ...

  20. Neurodegeneration Research Collection

    Type
    Collection
    ...understood, and there are no effective therapies to prevent, treat, or cure most of these disorders. An integrated...age of 60. There is presently no cure or way to prevent progression of PD. Treatment consists mainly of...
Showing: 61 - 80 of 741 results