Skip to main content
Addgene
Showing: 61 - 80 of 710 results

  1. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ... vectors - PCR-based C-terminal tagging in S. cerevisiae pCS2FLAG - N- or C-terminal 2xFLAG...of proteins on the extracellular surface of S. cerevisiae cells His-tagged versions of pFastBac LIC vectors...Plasmids page pBF3060 - Metabolic engineering in S. cerevisiae TALENs Gene targeting TALEN kits - Construct ... and expression of bacterial gene clusters S. cerevisiae plasmids for multiple marker selection TRP1 Yeast...InvivoGen trademark. Return to top Content last reviewed 28 May 2025. Do you have suggestions for other...

  2. Zhang Lab CRISPR Page

    Type
    Collection
    ... plasmid can be digested using SapI, which will reveal sticky ends to enable the rapid ligation of annealed...FA, Hsu PD, Lin CY, Gootenberg JS, Konermann S, Trevino AE, Scott DA, Inoue A, Matoba S, Zhang Y, Zhang...CRISPR-Cas9 complex. Konermann S*, Brigham MD*, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib...

  3. Cre-lox system

    Type
    Collection
    ... the region of DNA between the target sites is reversed. B) If the target sites are on the same DNA strand...-M) has been engineered to contain an intron, preventing Cre expression when cloning in E. coli . This...Maize Ubiquitin Plant Birchler 140131 pAAV-EF1a-NCreV N-terminal Cre component split with Vivid photodimers...photodimers EF-1 alpha AAV Zeng 140132 pAAV-EF1a-CCreV C-terminal Cre component split with Vivid photodimers...photodimers EF-1 alpha AAV Zeng 140135 pAAV-EF1a-iCreV Split Cre fused to nuclear localized wild-type VVD EF-... cassette) upstream of a gene of interest will prevent gene expression in the absence of Cre. In the presence...

  4. Genetic Code Expansion

    Type
    Collection
    ...pAB228v TrpRS S. cerevisiae Bacterial Ahmed Badran 209745 pAB228v6 TrpRS S. cerevisiae Bacterial Ahmed ...things to consider. If you are working off of a previously established protocol, make sure to match the ..., ncAA concentration, and the cell lines used previously. Remember that the orthogonal pairs of synthetase...209746 pAMC070n1a12 ScTrpRS, Lum1PylRS, MmPylRS S. cerevisiae, Lum1, M. mazei Bacterial Ahmed Badran 212125...

  5. Antibody Guide

    Type
    Collection
    ...Description Configuration and Valency Subclasses IgA Prevalent antibody in secretions (e.g. tears, saliva, mucus... in the cell, and sample processing can hide or reveal epitopes on an antigen. Monoclonal antibodies only...block the membrane to remove excess antibody and prevent unwanted binding. Incubate the membrane with a ...should be run with: a positive control, a sample previously verified to contain your protein of interest ...interest, as described in the IP section above. Reverse the crosslink, isolate DNA, and perform downstream...

  6. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...red fluorescent protein tagging vectors for S. cerevisiae. PLoS One. 2013 Jul 2;8(7):e67902. doi: 10.1371... fluorescent protein tagging in Saccharomyces cerevisiae. Yeast. 2004 Jun;21(8):661-70. doi: 10.1002/yea...selection markers for engineering in Saccharomyces cerevisiae. Microb Cell Fact. 2013 Oct 25;12:96. doi: 10.1186...

  7. Microbiology Resources

    Type
    Collection
    ... S. cerevisiae - Dueber Lab Yeast Prototrophy : Restoration of prototrophy in common S. cerevisiae lab...color. External Resources European Saccharomyces Cerevisiae Archive for Functional Analysis (EUROSCARF) (...

  8. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ... Lgi1 Mouse Mouse IgG2a 177528 Anti-Brevican [N294A/10R] Brevican Rat Mouse IgG2a 177529 Anti-GluN1 [N308...ARHGAP4 Mouse Mouse IgG2a 190309 Anti-Brevican [N294A/6] Brevican Rat Mouse IgG2a 190311 Anti-NSD1 [N312...Synaptotagmin-7 Mouse Mouse IgG2a 220429 Brevican [N294A/10R-2b] Brevican Rat Mouse IgG2a 220430 BAF53b [N332B...external) Human Mouse 206772 Brevican scFv [N294A/6] N294A/6 scFv Brevican Rat Mouse 206773 GluN3A/NR3A...

  9. Lentivirus ddPCR Titration

    Type
    Protocol
    ...primers and probes targeting integrated copies of the Rev response element (RRE) in the target cells but can...tgtgccttggaatgctagt probe (FAM): tttggaatcacacgacct reverse primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy...

  10. Sequencing Primers

    Type
    Guide
    ... forward primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus, reverse primer MT1-F GCTGTCCTCTAAGCGTCACC... forward primer tdTomato-Rev TCTTTGATGACGGCCATGT 5' end of tdTomato, reverse primer Tet-R GGCGAGTTTACGGGTTGTTA...forward primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer M13 Reverse CAGGAAACAGCTATGAC...DsRed1, reverse primer EBV Reverse GTGGTTTGTCCAAACTCATC (Invitrogen) SV40 polyA terminator, reverse primer...vector, reverse primer pHybLex Reverse GAGTCACTTTAAAATTTGTATACAC (Invitrogen) ADH terminator, reverse primer... AUG1 Reverse GAAGAGAAAAACATTAGTTGGC (Invitrogen) For Pichia vectors with AUG1 promoter, reverse primer...primer BGH Reverse TAGAAGGCACAGTCGAGG (Invitrogen) Bovine growth hormone terminator, reverse primer Bglob-intron-F...

  11. Mammalian RNAi Tools

    Type
    Collection
    ...Similarities and differences . Advanced Drug Delivery Reviews, 61 (9), 746–759. PubMed (Link opens in a new window..., Zhang, J., & Feng, L. (2023). A comprehensive review of small interfering RNAs (siRNAs): mechanism, ...

  12. CRISPR Plasmids and Resources

    Type
    Collection
    ...modified from a bacterial immune system to a revolutionary tool for genome engineering. CRISPR Topic Page...breaks. Prime Edit Cas nickase enzymes fused to reverse transcriptase install new genetic information into...

  13. Recombinases AAV Preps

    Type
    Collection
    ...Serotype(s) PI 140135 pAAV-EF1a-iCreV EF1a none 1, PHPeB Zeng 140136 pAAV-EF1a-iDreV EF1a none 1, PHPeB Zeng ...

  14. Retrovirus Plasmids

    Type
    Collection
    ...including reverse transcriptase and integrase. Once in a target cell, the virus uses the reverse transcriptase...

  15. Antibody Production

    Type
    Collection
    ...Usage” and “Delivery” conditions, so we recommend reviewing the specific antibody webpage for further information...the experiment is performed in parallel with a previous lot of recombinant antibody or the hybridoma-derived...

  16. Neurodegeneration Research Collection

    Type
    Collection
    ...understood, and there are no effective therapies to prevent, treat, or cure most of these disorders. An integrated...age of 60. There is presently no cure or way to prevent progression of PD. Treatment consists mainly of...

  17. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...a single genomic locus. Before ordering, please review the steps for using pooled CRISPR libraries and...Knockout Human Doench 3rd 2 40,964 Ingolia lab S cerevisiae CRISPRi v1 – barcodes 181005 161769 Inhibition...

  18. Plasmids for Stem Cell Research

    Type
    Collection
    ...Sox2 Integrative Analyses of Human Reprogramming Reveal Dynamic Nature of Induced Pluripotency. Cell. 2015... Lentiviral Human Direct Lineage Reprogramming Reveals Disease-Specific Phenotypes of Motor Neurons from...

  19. Chemogenetics Guide

    Type
    Guide
    ...for Causal Cellular and Neuronal Biology. Physiol Rev. 98:391–418. PMID: 29351511 (Link opens in a new ...Chemogenetic tools to interrogate brain functions. Annu Rev Neurosci. 37:378–407. PMID: 25002280 (Link opens ...alternatives for experiments. Perlapine has been previously used in human populations in Japan, making it..., Bonci A, Michaelides M (2017). Chemogenetics revealed: DREADD occupancy and activation via converted...
Showing: 61 - 80 of 710 results