We narrowed to 718 results for: STO;
-
TypeCollection...originally discovered as contaminants of adenovirus stocks. One major advantage of using AAV for research ... and learn about our options for hundreds of in-stock preps that are ready to ship right away, as well...
-
CRISPR Plasmids - Mammalian Expression
TypeCollection... Available modifications include histone acetylation by p300, histone demethylation by LSD1, cytosine ... -
Ras Pathway
TypeCollection...oncogene homolog Muscle RAS oncogene homolog Neuroblastoma RAS viral (v-ras) oncogene homolog RASA RASA1...RASSF10 Ras association domain family member RB1 Retinoblastoma 1 RCE1 Ras converting CAAX endopeptidase 1 ... -
CRISPR Guide
TypeCollection...insertions, or frameshift mutations leading to premature stop codons within the open reading frame (ORF) of the... cytosines in a gene’s promoter or by inducing histone acetylation or demethylation. The most common modifiers... green fluorescent protein (GFP), creating a customizable DNA or RNA label for fluorescence microscopy...gene by shifting the ORF and/or creating premature stop codons NHEJ N on- H omologous E nd J oining; A DNA... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Green Yellow Orange Red Far-Red Near-Infrared Long Stokes Shift Photoactivatable Photoconvertible Photoswitchable...HisB-iRFP720 - Bacterial Expression Jump to Top Long Stokes Shift Protein Excitation (nm) Emission (nm) Brightness... -
Genetic Code Expansion
TypeCollection...challenging. In E.coli , the rarest codon is the amber stop codon (UAG) and thus this codon is often used. The...sites changes to UAG, RF1 function removed, MutS restored so decreased mutation rate George Church 68306... -
Validated gRNA Sequences
TypeCollection...Winslow Lox-STOP-Lox synthetic GCGTATAGCATACATTATACG 66586 cut S. pyogenes 26018130 Xue Lox-STOP-Lox synthetic... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Empty gRNA expression vectors for insertion of custom gRNA target sequences...._LacZ 74293 Mammalian S. pyogenes Neo, mCherry Postovit pdCas9-DNMT3A-PuroR_v2 74407 Mammalian U6 yes,... -
Fluorescent Protein Guide: Biosensors
TypeCollection...Constitutive or Cre-dependent) Cell-specific restoration of stimulus preference after monocular deprivation...cpFRET kit from the Pertz laboratory to construct custom biosensors. The ScEnSor Kit from the Olsson laboratory... -
CRISPR Plasmids for Genomic Visualization
TypeCollection...like GFP, researchers have turned dCas9 into a customizable DNA labeler compatible with fluorescence microscopy... -
DNA Service - Cloning Grade DNA
TypeCollection...resources you may find helpful. Our Scientific and Customer Support Teams are also available to provide assistance... -
Bikard Lab - CRISPR Repression Collection
TypeCollection...possible to study the effect of the amount and stoichiometry of enzymes. The pLC97 plasmid allows for quick... -
CRISPR Plasmids and Resources
TypeCollection...discover links to CRISPR forums, and more. CRISPR History : Learn how CRISPR was modified from a bacterial... -
CRISPR Plasmids - C. elegans
TypeCollection...Ingestion by C. elegans none, need Cas9 plasmid Ristow Do you have suggestions for other plasmids that... -
Recombinases AAV Preps
TypeCollection...Recombinases VCre AAV Browse the following tables for in-stock AAV preps that encode site-specific recombinases... -
Synthetic Biology - Overview
TypeCollection...Lei Stanley Qi Jeff Tabor Jan-Willem Veening Christopher Voigt Clifford Wang Ron Weiss Synthetic biology... -
Synthetic Biology - Assembly Standards Guide
TypeCollection...Scar: ACCGGC Features: Modified RFC 10 w/ start and stop codons; Creates in-frame fusions w/ linker Thr-Gly... -
Promega Plasmid Collection
TypeCollection...visualization, and functional studies. You can even customize ligands for your specific purpose. HaloTag technology... -
Distribution to Industry
TypeCollection...SUMO Protease Elution Protein Characterization Christopher Bahl A validation set of 96 unique, single-domain... -
Plant Plasmids and Resources
TypeCollection...reproduces, and distributes diverse seed and other stocks of Arabidopsis thaliana and related species. The...