... 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740...pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740...GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186 Liu near LoxP sites synthetic CGAAGTTATATTAAGGGTTC 69992 cut S. pyogenes...

...changes, researchers use ssDNA or dsDNA repair templates with 1. homology to the DNA flanking the DSB and...Insert Promoter Selectable Marker PI Publication Parasites Plasmid Gene/Insert Promoter Selectable Marker...

...Brzezinski Lab CRISPR Collection The Brzezinski lab investigates gene regulation in the context of the developing...fusion shuttle plasmid for shuttling U6-guide cassettes to make dual guide expressing plasmids dCas9-KRAB-MeCP2...

...target sites in cultured U2OS cells. Target Gene Name TALENs Full Target Site (5' to 3'; half-sites in CAPS...

...contains pre-assembled genetic circuits such as logic gates and higher level gene networks. Sensing and Signaling...Quorum Sensing Ellis Lab GeneGuard Endy Lab Logic Gates , BIOFAB Promoter/BCD Kit , and pOSIP Plasmid Kit...

...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ... transcription factor and other protein binding sites. Plasmid Gene/Insert Promoter Selectable Marker ...

... length of the spacer sequence between the half-sites (see Nuclease Expression Vectors for more details...two-hybrid reporter system but have NOT yet been tested for activity as ZFNs in zebrafish. Target Gene ...

...microbial fields, including bacteria, viruses, parasites such as protozoa, and fungi. Find plasmids below...microbiology resources. The plasmids Addgene distributes cannot be used to reconstitute self-replicating...

...set of plasmids for building homologous repair templates that incorporate a self-excising drug selection...Center (CGC) - The CGC collects, maintains, and distributes stocks of C. elegans. Silencing Genomes - Cold...

...DNA is precipitated with alcohol and resuspended in TE buffer. After this, the DNA is ready for use! Plasmid...centrifugation and washed before DNA is eluted with water or TE. The Bishop Lab’s glass milk protocol is adapted ...than 30 minutes and only requires incubating the columns with 1M phosphoric acid for 3 minutes followed...syringe-based method can be completed in 20 to 30 minutes. Additionally, while commercial plasmid prep kits...same as those provided with the kit. Although not tested by the authors, it’s possible that used plasmid... the National Academy of Sciences of the United States of America, 76 2, 615-9 . https://doi.org/10.1073...

...interference demonstrates a role for Nramp1 in modifying susceptibility to type 1 diabetes. Kissler S, ...

...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ... transcription factor and other protein binding sites. Plasmid Gene/Insert Promoter PI Publication 3xFLAG-dCas9...

...Boender et al. Sci Adv. 2023 Jun 2. Use Cas9 in astrocytes. Endo et al Science. 2022 Nov 4. Base edit human...Alzheimer’s disease and related disorders. The site curates information on useful resources such as: Antibodies...

... procedures. Additionally, because this virus integrates randomly into the host genome, it has the potential...interest, also can express shRNA (cloning H1-shRNA cassettes into the unique SnaBI site in the 3´-LTR). See...

...-CoV-2 detection assay for laboratory and home testing. Kellner, et al. bioRxiv 2020.06.23.166397 reverse... Endy and Philippa Marrack Labs. Point-of-care testing for COVID-19 using SHERLOCK diagnostics. Joung ...

...window) PMID: 10508514 2007 - Adrian Bird's lab demonstrates that Rett syndrome symptoms are reversible in...Joost Gribnau Xist 2lox/2lox Conditional Xist, Lox sites flanking exon 1,2,3 C57BL/6 Mouse line with conditional...

...staining, in vitro and (when possible) in vivo testing, and full sequencing of the final viral vector ...vector preparation. In some cases, in vivo testing of these viral preparations was performed by the Karpova...

...secreted version of the protein is available – these attributes have made it popular with scientists since its...luciferase reporter vector via Gateway cloning to test for the presence of transcriptional regulatory region...

...Isoamyl alcohol (49:1) 75% Ethanol RNase-free water or TE solution RNase free tubes: microcentrifuge tubes,...residual ethanol wash and add RNase-free water or TE as soon as the entire tube is dried but while the...visible. Resuspend RNA pellet in RNase-free water or TE. Quantify and assess the quality of your RNA sample...Incubate sample(s) for 15 minutes on ice and centrifuge the sample(s) for 15 minutes at 12,000 × g at 4°C ...Incubate the sample(s) for 2-3 minutes on ice and centrifuge for 15 minutes at 12,000 × g at 4°C to separate...

...DNA? by Paolo Colombi Should I store my plasmid in TE, Tris, or water? And what about temperature? Find... Jennifer Tsang The nanodrop vs. spec debate dominates DNA quantification discussions, but what about...