Skip to main content

We narrowed to 911 results for: Tro

Showing: 881 - 900 of 911 results
  1. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...studied, and has a broad tissue tropism. Table 1 gives a summary of the tropism of AAV serotypes, indicating...variant able to display neuronal retrograde transport, AAVrg. Retrograde transport refers to the direction...disease, spinal muscular atrophy, hemophilia A and B, and Duchenne muscular dystrophy. Many clinical trials...injection. Different AAV serotypes exhibit strong neuronal tropism, meaning they can efficiently target specific...therefore non-pathogenic and generally do not trigger a strong immune response. These features have made AAVs ...are transfected into cells which then act as in vitro factories for the new viral particles in the laboratory...serotypes are AAV variants that differ in their tropism — that is, the types of cells they infect. Serotypes...
  2. Antibody Guide

    Type
    Guide
    ...negative control. The negative control may be a no-antibody control in which a sample is processed without ...standard curve can serve as the positive control); and a negative control, a sample known not to contain your...interest. The negative control should be biological (no protein expressed), which controls for your antibody...fragmentation of the DNA. Controls for capture methods Capture methods should use a positive control and a negative...addition to the control used in standard IP, ChIP should additionally use a beads-only control which runs ...the machine. Controls for cell sorting methods Flow cytometry requires a negative control, a small subset...animal’s immune system. The antigen of interest is introduced to the animal, which then mounts an immune response...
  3. Optogenetics Guide

    Type
    Guide
    ...(genetically-encoded tools for light-activated control of proteins) and sensors (genetically-encoded reporters... common optogenetic actuators used for optical control of proteins and cells, including microbial opsins...These various opsins also initiate different electrochemical responses, such as nonspecific cation influx...subsets of neurons, allowing precise spatiotemporal control of these neurons by turning on and off the light...Wild-type halorhodopsin, known as NpHR (from Natronomonas pharaoni ), causes hyperpolarization (inhibition.../NpHR Light-driven inward chloride pump from Natronomonas pharaonis , used to silence neuronal activity...illuminated. There are several different ways to control opsin expression. Generally, the most robust and...
  4. Promoters

    Type
    Guide
    ...Constitutive Insect Strong promoter from baculovirus CAG Constitutive Mammalian Strong hybrid promoter; ...Constitutive Mammalian Strong promoter from human cytomegalovirus EF1a Constituitve Mammalian Strong promoter from...vital component of expression vectors because they control the binding of the RNA polymerase to DNA. RNA polymerase... functional protein. Thus, the promoter region controls when and where in the organism your gene of interest... are proteins which recruit RNA polymerase and control and regulate the transcription of DNA into mRNA... bind to a promoter. Transcription is tightly controlled in both bacteria and eukaryotes by various DNA...consists of the sequence TTGACA, and this element controls the rate of transcription. Bacterial cells contain...
  5. Molecular Biology Reference

    Type
    Guide
    ...strength of the promoter can control the level of insert expression, as a strong promoter directs high expression...BL21 Invitrogen; New England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA...molecular pathways and diseases. Here we present an introduction to plasmids and a collection of other molecular...genes as carriers of phenotypic information was introduced in the early 19th century by Gregor Mendel, who... restriction enzymes, DNA ligases, and gel electrophoresis enabled the movement of specific fragments ...of another antibiotic resistance gene under the control of a non-bacterial promoter or a fluorescent protein...create viral particles (most commonly lentiviral, retroviral, AAV, or adenoviral particles) that can infect...
  6. Adenovirus Guide

    Type
    Guide
    ...Addgene's Blog An Introduction to Adenovirus Adenoviral Vector Production and Troubleshooting Adenoviral Delivery...recognizes adenoviral elements rapidly and can mount a strong immune response quickly, which has limited their...double-stranded circular episomes. Due to this, and to the strong host’s immune response against the transduced cells...G). Different serotypes exhibit varying tissue tropisms, meaning they preferentially infect certain tissues...proteins. Researchers have further refined the tropism of rAdV vectors by mixing capsids and genomes from...vector features such as transduction efficiency, tropism and immunogenicity. For example, Ad5/35 and Ad5...viral vector uptake and transgene expression. This strong immune response has become a disadvantage for the...
  7. CRISPR Guide

    Type
    Guide
    ...provide a basic understanding of CRISPR biology, introduce the various applications of CRISPR, and help you...research. CRISPR Basics In this section, we will introduce the basic mechanisms of CRISPR and some of the... nuclease fidelity SpCas9-NG — NG; increased in vitro activity SpG — NGN; increased nuclease activity ...-occurring Acr (Anti-CRISPR) proteins can help control CRISPR activity. Acr proteins have evolved in phages...LmoCas9 and SpCas9. Acr proteins can be used to control both when and where genome editing happens. CASANOVA...Dominik Niopek’s lab , is a way to optogenetically control genome editing by fusing the anti-CRISPR protein...photosensitive LOV2 domain . Several labs have also controlled Acr activity with endogenous cell-type specific...
  8. Chemogenetics Guide

    Type
    Guide
    ... However, neuronal control through PSAMs and LMOs is direct, while neuronal control of DREADDs is indirect...endogenous signaling, therefore allowing precise control over the cell population they are targeted to. ...used in the same organism to allow bidirectional control of neuronal activity. Table 1: Descriptions of ...chemogenetic receptors that confer more direct control of neurons through manipulation of ion channels...expression of AAV-delivered constructs can be controlled with cell-type specific promoters. Table 4 lists...unwanted cell types. Generating a FLEx switch to control expression of a chemogenetic reporter ensures that...N. C. (2024). Efficient opto- and chemogenetic control in a single molecule driven by FRET-modified bioluminescence...
  9. Plan Your Experiment

    Type
    Guide
    ...CRISPR Experiment Jump To: Plan Your Experiment Introduction Select Genetic Manipulation Design and Clone...generally perform by chemical transfection or electroporation. Expression can be transient, or you can generate... of Cas and gRNA. This method involves using in vitro transcription reactions to generate mature Cas mRNA... to target cells through microinjection or electroporation. The target cells translate the mRNA encoding...you directly combine purified Cas protein and in vitro transcribed gRNA to form a Cas-gRNA complex. You...delivery the RNP to cells using cationic lipids, electroporation, or an endosomal approach. Similar to the mRNA...Weissman, J. S. (2014). Genome-Scale CRISPR-Mediated control of gene repression and activation. Cell , 159 (...
  10. Guide to Using Pooled Libraries

    Type
    Guide
    ...Pooled Libraries Jump To: Pooled Library Guide Introduction Library Amplification Types of Screens Resources...postivie or negative screens. The use of appropriate controls (positive and negative) is the responsibility ...the same basic process: Amplify the library (electroporation and maxiprep). If delivering as virus, make... Perform Next Generation Sequencing (NGS) on a control sample (no selection) In parallel, apply library...cells Compare NGS results between experimental and control cells Generate a list of gRNAs that disappear with... post-selection. The selective pressure must be strong enough that most of the cells die, removing their...selection while the other serves as a non-selected control. These two populations are then sequenced using...
  11. Sequencing Primers

    Type
    Guide
    ...Reverse Bglob-intron-F CTGGTCATCATCCTGCCTTT Rabbit beta-globin intron Forward Bglob-intron-R TTTGCCCCCTCCATATAACA...for inserts in pBMN retroviral vector MMLV sequence, for inserts in pBMN retroviral vector Forward pBR322ori-F...TTTGCCCCCTCCATATAACA Rabbit beta-globin intron Reverse Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA... pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids Forward pCasper-F GGGTTTTATTAACTTACAT...pMT2-F TTGCCTTTCTCTCCACAGGT 3' end of synthetic intron Forward pMX-S1811 GACGGCATCGCAGCTTGGATACAC MMLV...
  12. Protocol - How to Streak a Plate

    Type
    Protocol
    ...Recovering Plasmid DNA from Bacterial Culture Introduction If you have a glycerol stock or stab culture...would hold a pencil, so that you can make a broad stroke. Only touch the surface of the plate, do NOT dig...
  13. Protocol - Over-Agar Antibiotic Plating

    Type
    Protocol
    ...Recovering Plasmid DNA from Bacterial Culture Introduction This protocol describes methodology for plating...concentrations of carbenicillin plated over-agar. Control Plate with No Carbenicillin Plate shows a lawn ...
  14. Weighing Reagents Protocol

    Type
    Protocol
    ...Protocols Weighing Reagents Weighing Reagents Protocol Intro to the Lab Bench Check out more protocols and videos...videos to help you get started in the lab! Introduction For many experiments, you’ll need to make buffers...
  15. Water Bath Protocol

    Type
    Protocol
    ... Protocols Water Bath Water Bath Protocol Intro to the Lab Bench Check out more protocols and videos...videos to help you get started in the lab! Introduction A water bath is a piece of laboratory equipment...
  16. Modular Cloning Guide

    Type
    Guide
    .... MoClo Plant Parts Kit Plant Expression Nicola Patron 95 standardized parts specific for plant synthetic...Toolkit Yeast Expression Volker Sieber Plasmids with control elements and fluorescent reporters to be used in...Toolkit Bacterial Expression, Fungal Expression Nili Ostrov , Charlie Gilbert , and Cultivarium Tools 189 plasmids...MoClo-compatible CRISPR/Cas9 cloning kit with intronized Cas9 Genome Engineering, CRISPR Sylvestre Marillonnet...constructs are made with zCas9i, a high efficiency intron-optimized SpCas9-coding gene. MoClo CRISPR/Cas ...Resources Guide to DNA Assembly Techniques by Nicola Patron at The Sainsbury Laboratory Weber E, Engler C, ... M, Gruetzner R, Ehnert TM, Werner S, Jones JD, Patron NJ, Marillonnet S. A golden gate modular cloning...
  17. General Transfection

    Type
    Protocol
    ...Virus Blog Posts Mol Bio Protocols Viral Service Introduction This protocol describes a general method for...channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container Reagents DMEM high ...
  18. Pipetting Protocol

    Type
    Protocol
    ... Protocols Pipetting Pipetting Protocol Intro to the Lab Bench Check out more protocols and videos...videos to help you get started in the lab! Introduction The pipette is an essential tool for nearly anyone...
  19. AAV Purification by Iodixanol Gradient Ultracentrifugation

    Type
    Protocol
    ...Vector Guides Virus Blog Posts Mol Bio Protocols Introduction This protocol can be used to purify AAV of any...VP2, VP3; M protein marker. Image adapted from Strobel Benjamin, Miller Felix D., Rist Wolfgang, and Lamla...
Showing: 881 - 900 of 911 results