We narrowed to 923 results for: Tro
-
TypeProtocol...Virus Blog Posts Mol Bio Protocols Viral Service Introduction This protocol can be used to generate stable...channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container Reagents DMEM high ...plate will hold 5 dilutions plus one 'no virus' control well). Perform a "reverse transduction" by seeding...selection should last at least as long as it takes the control (untransduced) cells to completely die. After that...
-
Isolating a Monoclonal Cell Population by Limiting Dilution
TypeProtocol...express Cas9 and are included as a control (WT). Vinculin is a loading control. 1 lentiCas9-Blast was a gift...Virus Blog Posts Addgene Protocols Viral Service Introduction This protocol describes how to generate a monoclonal...µL single channel pipette CO 2 incubator Pipet controller Hazardous waste container Microscope Hemocytometer... -
Protocol - How to Perform Sequence Analysis
TypeProtocol...Design a Primer Diagnostic Restriction Digest Introduction Sequence verification of important plasmid features... do not sequence the entire plasmid. Addgene strongly recommends that you sequence any portion of the...What primers were used by Addgene during quality control? Addgene lists the primers used to obtain each ... -
Ligation Independent Cloning
TypeProtocol...cloning scars"). A “stuffer” sequence allows for electrophoretic separation of linearized vector from the reaction...linearized vector from the reaction mixture by gel electrophoresis followed by gel purification . The cut vector... your chances of success. Set up a vector only control with water instead of the insert. Incubate the ... -
Centrifugation
TypeProtocol...Protocols Centrifugation Centrifugation Protocol Intro to the Lab Bench Check out more protocols and videos...videos to help you get started in the lab! Introduction A centrifuge is a common piece of laboratory equipment...the rotor with microfuge tubes in place, and the control panel where you can set the time and speed needed... -
Gibson Assembly Protocol
TypeProtocol...and 30 bp annealing to the target sequence. Avoid strong secondary structures in the homology region. Hairpins...seams between the assembled parts. Tips and Troubleshooting “Stitching” fragments together using oligos...oligos. This technique is especially useful for introducing promoters, terminators, and other short sequences... -
Lab Safety for Biosafety Levels One and Two
TypeProtocol... Biosafety Levels One and Two (BSL-1 and BSL-2) Intro to the Lab Bench Check out more protocols and videos...videos to help you get started in the lab! Introduction There are four biosafety levels. This protocol...protocols require bloodborne pathogens training. It is strongly recommended that anyone participating in BSL-2... -
Lentivirus Production
TypeProtocol...like... Viral Vector Guides Mol Bio Protocols Introduction This protocol can be used to produce lentivirus...channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container pH meter Stir plate... should be aliquoted and snap frozen in liquid nitrogen and stored at -80 °C as soon as possible to avoid... -
Handling Plasmids from Addgene - Purifying Plasmid DNA
TypeProtocol...like... Bacterial Transformation Agarose Gel Electrophoresis Agarose Gel DNA Purification Streaking and ...Bacteria Inoculating a Liquid Bacterial Culture Introduction Many molecular biology techniques require highly...window) Qiagen , (Link opens in a new window) Invitrogen , and (Link opens in a new window) Promega sell... -
What is Polymerase Chain Reaction (PCR)
TypeProtocol...standard Polymerase Chain Reaction (PCR) is an in vitro method that allows a single, short region of a DNA...product can be verified based on size by gel electrophoresis . Protocol Video Watch the protocol video below...to each reaction. The ideal setup for this troubleshooting step is to do one reaction with each, and one... -
AAV Titration by qPCR Using SYBR Green Technology
TypeProtocol...Vector Guides Virus Blog Posts Mol Bio Protocols Introduction The AAV Titration protocol can be used to determine...samples being tested. Always include a No Template Control (NTC), i.e master mix + water Whenever possible...duplicate. Do not forget to include a no template control ( NTC = master mix + water ). Add 15 μL of Master... -
Sequencing Primers
TypeGuide...beta-globin intron, forward primer Bglob-intron-R TTTGCCCCCTCCATATAACA Rabbit beta-globin intron, reverse...TAGAAGGCACAGTCGAGG (Invitrogen) Bovine growth hormone terminator, reverse primer Bglob-intron-F CTGGTCATCATCCTGCCTTT...CCCAGTCACGACGTTGTAAAACG (Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene...AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For...Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward ...Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse...reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward... -
Lentiviral Vector Guide
TypeGuide... Versus Gamma-Retrovirus Lentiviruses and gamma-retroviruses fall under the Retroviridae family. The genome...Glossary Lentiviruses are a type of retrovirus and belong to the Retroviridae family. Infection with lentiviruses...variety of cell types than retroviruses. Both lentiviruses and gamma-retroviruses use the same packaging ...packaged by gamma-retroviral packaging systems, and vice versa. For more about gamma-retroviruses, see Addgene's...Panch, S. R., Jin, P., & Stroncek, D. F. (2022). Genome-wide profiling of retroviral DNA integration and its..., leading to disease. Lentivirus A retrovirus from the Retroviridae family. Characterized by long incubation...BIV), and feline immunodeficiency virus (FIV). Retroviruses are partially characterized by their ability... -
Adeno-associated virus (AAV) Guide
TypeGuide...studied, and has a broad tissue tropism. Table 1 gives a summary of the tropism of AAV serotypes, indicating...variant able to display neuronal retrograde transport, AAVrg. Retrograde transport refers to the direction...disease, spinal muscular atrophy, hemophilia A and B, and Duchenne muscular dystrophy. Many clinical trials...injection. Different AAV serotypes exhibit strong neuronal tropism, meaning they can efficiently target specific...therefore non-pathogenic and generally do not trigger a strong immune response. These features have made AAVs ...are transfected into cells which then act as in vitro factories for the new viral particles in the laboratory...serotypes are AAV variants that differ in their tropism — that is, the types of cells they infect. Serotypes... -
Antibody Guide
TypeGuide...negative control. The negative control may be a no-antibody control in which a sample is processed without ...standard curve can serve as the positive control); and a negative control, a sample known not to contain your...interest. The negative control should be biological (no protein expressed), which controls for your antibody...fragmentation of the DNA. Controls for capture methods Capture methods should use a positive control and a negative...addition to the control used in standard IP, ChIP should additionally use a beads-only control which runs ...the machine. Controls for cell sorting methods Flow cytometry requires a negative control, a small subset...animal’s immune system. The antigen of interest is introduced to the animal, which then mounts an immune response... -
Optogenetics Guide
TypeGuide...Optogenetics Guide Introduction Microbial Opsins Optical Switches References Introduction The field of optogenetics...research utilize light to detect, measure, and control molecular signals and cells in order to understand... genetically-encoded tools for light-activated control of proteins; e.g., microbial opsins and optical...These various opsins also initiate different electrochemical responses, such as nonspecific cation influx...subsets of neurons, allowing precise spatiotemporal control of these neurons by turning on and off the light...Wild-type halorhodopsin, known as NpHR (from Natronomonas pharaoni ), causes hyperpolarization (inhibition.../NpHR Light-driven inward chloride pump from Natronomonas pharaonis , used to silence neuronal activity... -
Molecular Biology Reference
TypeGuide...is also important for controlling the level of insert expression (i.e., a strong promoter directs high...BL21 Invitrogen; New England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA...Genetics Plasmid Elements Working with Plasmids Introduction Types of Plasmids E. coli strains for propagating...genes as carriers of phenotypic information was introduced in the early 19th century by Gregor Mendel, who...of restriction enzymes, DNA ligase, and gel electrophoresis allowed for the ability to move specific fragments...that the antibiotic resistance gene is under the control of a bacterial promoter, and is thus expressed ...antibiotic resistance gene (this time, under the control of a non-bacterial promoter) or a fluorescent protein... -
Promoters
TypeGuide...Transcription is tightly controlled in both bacteria and eukaryotes. Promoters are controlled by various DNA regulatory...Constitutive Strong mammalian promoter from human cytomegalovirus EF1a Constituitve Strong mammalian promoter...vital component of expression vectors because they control the binding of RNA polymerase to DNA. RNA polymerase...a functional protein. Thus the promoter region controls when and where in the organism your gene of interest... are proteins which recruit RNA polymerase and control and regulate the transcription of DNA into mRNA...human elongation factor 1 alpha CAG Constitutive Strong hybrid mammalian promoter PGK Constitutive Mammalian...consists of the sequence TTGACA and this element controls the rate of transcription. Bacterial cells contain... -
Adenovirus Guide
TypeGuide...Addgene's Blog An Introduction to Adenovirus Adenoviral Vector Production and Troubleshooting Adenoviral Delivery...recognizes adenoviral elements rapidly and can mount a strong immune response quickly, which has limited their...double-stranded circular episomes. Due to this, and to the strong host’s immune response against the transduced cells...G). Different serotypes exhibit varying tissue tropisms, meaning they preferentially infect certain tissues...proteins. Researchers have further refined the tropism of rAdV vectors by mixing capsids and genomes from...vector features such as transduction efficiency, tropism and immunogenicity. For example, Ad5/35 and Ad5...viral vector uptake and transgene expression. This strong immune response has become a disadvantage for the... -
CRISPR Guide
TypeGuide...provide a basic understanding of CRISPR biology, introduce the various applications of CRISPR, and help you...research. CRISPR Basics In this section, we will introduce the basic mechanisms of CRISPR and some of the...increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease activity SpRY...-occurring Acr (Anti-CRISPR) proteins can help control CRISPR activity. Acr proteins have evolved in phages...LmoCas9 and SpCas9. Acr proteins can be used to control both when and where genome editing happens. CASANOVA...Dominik Niopek’s lab , is a way to optogenetically control genome editing by fusing the anti-CRISPR protein...photosensitive LOV2 domain . Several labs have also controlled Acr activity with endogenous cell-type specific...