Skip to main content

We narrowed to 917 results for: tro

Showing: 881 - 900 of 917 results
  1. Lab Safety for Biosafety Levels One and Two

    Type
    Protocol
    ... Biosafety Levels One and Two (BSL-1 and BSL-2) Intro to the Lab Bench Check out more protocols and videos...videos to help you get started in the lab! Introduction There are four biosafety levels. This protocol...protocols require bloodborne pathogens training. It is strongly recommended that anyone participating in BSL-2...
  2. Lentivirus Production

    Type
    Protocol
    ...like... Viral Vector Guides Mol Bio Protocols Introduction This protocol can be used to produce lentivirus...channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container pH meter Stir plate... should be aliquoted and snap frozen in liquid nitrogen and stored at -80 °C as soon as possible to avoid...
  3. Handling Plasmids from Addgene - Purifying Plasmid DNA

    Type
    Protocol
    ...like... Bacterial Transformation Agarose Gel Electrophoresis Agarose Gel DNA Purification Streaking and ...Bacteria Inoculating a Liquid Bacterial Culture Introduction Many molecular biology techniques require highly...window) Qiagen , (Link opens in a new window) Invitrogen , and (Link opens in a new window) Promega sell...
  4. What is Polymerase Chain Reaction (PCR)

    Type
    Protocol
    ...standard Polymerase Chain Reaction (PCR) is an in vitro method that allows a single, short region of a DNA...product can be verified based on size by gel electrophoresis . Protocol Video Watch the protocol video below...to each reaction. The ideal setup for this troubleshooting step is to do one reaction with each, and one...
  5. AAV Titration by qPCR Using SYBR Green Technology

    Type
    Protocol
    ...Vector Guides Virus Blog Posts Mol Bio Protocols Introduction The AAV Titration protocol can be used to determine...samples being tested. Always include a No Template Control (NTC), i.e master mix + water Whenever possible...duplicate. Do not forget to include a no template control ( NTC = master mix + water ). Add 15 μL of Master...
  6. Lentiviral Vector Guide

    Type
    Guide
    ... Versus Gamma-Retrovirus Lentiviruses and gamma-retroviruses fall under the Retroviridae family. The genome...Credits Lentiviruses are a type of retrovirus and belong to the Retroviridae family. Infection with lentiviruses...variety of cell types than retroviruses. Both lentiviruses and gamma-retroviruses use the same packaging ...packaged by gamma-retroviral packaging systems, and vice versa. For more about gamma-retroviruses, see Addgene's...Panch, S. R., Jin, P., & Stroncek, D. F. (2022). Genome-wide profiling of retroviral DNA integration and its..., leading to disease. Lentivirus A retrovirus from the Retroviridae family. Characterized by long incubation...BIV), and feline immunodeficiency virus (FIV). Retroviruses are partially characterized by their ability...
  7. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...studied, and has a broad tissue tropism. Table 1 gives a summary of the tropism of AAV serotypes, indicating...variant able to display neuronal retrograde transport, AAVrg. Retrograde transport refers to the direction...disease, spinal muscular atrophy, hemophilia A and B, and Duchenne muscular dystrophy. Many clinical trials...injection. Different AAV serotypes exhibit strong neuronal tropism, meaning they can efficiently target specific...therefore non-pathogenic and generally do not trigger a strong immune response. These features have made AAVs ...are transfected into cells which then act as in vitro factories for the new viral particles in the laboratory...serotypes are AAV variants that differ in their tropism — that is, the types of cells they infect. Serotypes...
  8. Optogenetics Guide

    Type
    Guide
    ...useful for controlling neuronal activity, but they can be deployed to interrogate and control a wide variety...generation of reactive oxygen species or to introduce contrast for electron microscopy 450 pDawn/pDusk Use pDusk..., a behavior that can be harnessed for precise control of electrical activity in a target cell type. OptoXRs...These various opsins also initiate different electrochemical responses, such as nonspecific cation influx...subsets of neurons, allowing precise spatiotemporal control of these neurons by turning on and off the light...Wild-type halorhodopsin, known as NpHR (from Natronomonas pharaoni ), causes hyperpolarization (inhibition... in animal cells, but they can be difficult to control precisely due to the complexity of these signaling...
  9. Antibody Guide

    Type
    Guide
    ...negative control. The negative control may be a no-antibody control in which a sample is processed without ...standard curve can serve as the positive control); and a negative control, a sample known not to contain your...interest. The negative control should be biological (no protein expressed), which controls for your antibody...fragmentation of the DNA. Controls for capture methods Capture methods should use a positive control and a negative...addition to the control used in standard IP, ChIP should additionally use a beads-only control which runs ...the machine. Controls for cell sorting methods Flow cytometry requires a negative control, a small subset...animal’s immune system. The antigen of interest is introduced to the animal, which then mounts an immune response...
  10. Promoters

    Type
    Guide
    ...Constitutive Insect Strong promoter from baculovirus CAG Constitutive Mammalian Strong hybrid promoter; ...Constitutive Mammalian Strong promoter from human cytomegalovirus EF1a Constituitve Mammalian Strong promoter from...vital component of expression vectors because they control the binding of the RNA polymerase to DNA. RNA polymerase... functional protein. Thus, the promoter region controls when and where in the organism your gene of interest... are proteins which recruit RNA polymerase and control and regulate the transcription of DNA into mRNA... bind to a promoter. Transcription is tightly controlled in both bacteria and eukaryotes by various DNA...consists of the sequence TTGACA, and this element controls the rate of transcription. Bacterial cells contain...
  11. Molecular Biology Reference

    Type
    Guide
    ...strength of the promoter can control the level of insert expression, as a strong promoter directs high expression...BL21 Invitrogen; New England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA...molecular pathways and diseases. Here we present an introduction to plasmids and a collection of other molecular...genes as carriers of phenotypic information was introduced in the early 19th century by Gregor Mendel, who... restriction enzymes, DNA ligases, and gel electrophoresis enabled the movement of specific fragments ...of another antibiotic resistance gene under the control of a non-bacterial promoter or a fluorescent protein...create viral particles (most commonly lentiviral, retroviral, AAV, or adenoviral particles) that can infect...
  12. Adenovirus Guide

    Type
    Guide
    ...Addgene's Blog An Introduction to Adenovirus Adenoviral Vector Production and Troubleshooting Adenoviral Delivery...recognizes adenoviral elements rapidly and can mount a strong immune response quickly, which has limited their...double-stranded circular episomes. Due to this, and to the strong host’s immune response against the transduced cells...G). Different serotypes exhibit varying tissue tropisms, meaning they preferentially infect certain tissues...proteins. Researchers have further refined the tropism of rAdV vectors by mixing capsids and genomes from...vector features such as transduction efficiency, tropism and immunogenicity. For example, Ad5/35 and Ad5...viral vector uptake and transgene expression. This strong immune response has become a disadvantage for the...
  13. CRISPR Guide

    Type
    Guide
    ...provide a basic understanding of CRISPR biology, introduce the various applications of CRISPR, and help you...research. CRISPR Basics In this section, we will introduce the basic mechanisms of CRISPR and some of the... nuclease fidelity SpCas9-NG — NG; increased in vitro activity SpG — NGN; increased nuclease activity ...-occurring Acr (Anti-CRISPR) proteins can help control CRISPR activity. Acr proteins have evolved in phages...LmoCas9 and SpCas9. Acr proteins can be used to control both when and where genome editing happens. CASANOVA...Dominik Niopek’s lab , is a way to optogenetically control genome editing by fusing the anti-CRISPR protein...photosensitive LOV2 domain . Several labs have also controlled Acr activity with endogenous cell-type specific...
  14. Guide to Using Pooled Libraries

    Type
    Guide
    ... such as barcoding or targeting RNA. Advantages Strong, specific loss of function (knockout) or gain-of-function...created from genomic DNA. Since cDNA libraries lack introns and other nontranscribed sequences, they are smaller...discovery, and functional complementation. Advantages Strong and uniform overexpression Independent of chromatin...postivie or negative screens. The use of appropriate controls (positive and negative) is the responsibility ...applying to cells, the library must be amplified (electroporation and maxiprep) and packaged into lentiviral ...survive selection. The selective pressure must be strong enough that most of the cells die, removing their...Negative screen: Apply library Perform NGS on a control sample (no selection) Apply selection; most cells...
  15. Chemogenetics Guide

    Type
    Guide
    ... However, neuronal control through PSAMs and LMOs is direct, while neuronal control of DREADDs is indirect... affect endogenous signaling, allowing precise control over a targeted cell population. Read this guide...used in the same organism to allow bidirectional control of neuronal activity. Table 1: Descriptions of ...chemogenetic receptors that confer more direct control of neurons through manipulation of ion channels...expression of AAV-delivered constructs can be controlled with cell-type specific promoters. Table 4 lists...unwanted cell types. Generating a FLEx switch to control expression of a chemogenetic reporter ensures that...N. C. (2024). Efficient opto- and chemogenetic control in a single molecule driven by FRET-modified bioluminescence...
  16. Plan Your Experiment

    Type
    Guide
    ...CRISPR Experiment Jump To: Plan Your Experiment Introduction Select Genetic Manipulation Design and Clone...generally perform by chemical transfection or electroporation. Expression can be transient, or you can generate... of Cas and gRNA. This method involves using in vitro transcription reactions to generate mature Cas mRNA... to target cells through microinjection or electroporation. The target cells translate the mRNA encoding...you directly combine purified Cas protein and in vitro transcribed gRNA to form a Cas-gRNA complex. You...delivery the RNP to cells using cationic lipids, electroporation, or an endosomal approach. Similar to the mRNA...Weissman, J. S. (2014). Genome-Scale CRISPR-Mediated control of gene repression and activation. Cell , 159 (...
  17. Sequencing Primers

    Type
    Guide
    ...Reverse Bglob-intron-F CTGGTCATCATCCTGCCTTT Rabbit beta-globin intron Forward Bglob-intron-R TTTGCCCCCTCCATATAACA...for inserts in pBMN retroviral vector MMLV sequence, for inserts in pBMN retroviral vector Forward pBR322ori-F...TTTGCCCCCTCCATATAACA Rabbit beta-globin intron Reverse Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA... pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids Forward pCasper-F GGGTTTTATTAACTTACAT...pMT2-F TTGCCTTTCTCTCCACAGGT 3' end of synthetic intron Forward pMX-S1811 GACGGCATCGCAGCTTGGATACAC MMLV...
  18. Protocol - How to Streak a Plate

    Type
    Protocol
    ...Recovering Plasmid DNA from Bacterial Culture Introduction If you have a glycerol stock or stab culture...would hold a pencil, so that you can make a broad stroke. Only touch the surface of the plate, do NOT dig...
  19. Protocol - Over-Agar Antibiotic Plating

    Type
    Protocol
    ...Recovering Plasmid DNA from Bacterial Culture Introduction This protocol describes methodology for plating...concentrations of carbenicillin plated over-agar. Control Plate with No Carbenicillin Plate shows a lawn ...
Showing: 881 - 900 of 917 results