Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 965 results for: form

Showing: 921 - 940 of 965 results

  1. CRISPR Library Amplification

    Type
    Protocol
    ... Day 1: Transform, recover, set up overnight growth (Estimated time 2-3 hours) Transformation should be...of 5 mL (3 mL SOC + 2 mL transformed Endura from two separate transformations). Pro-Tip Do not pipette...Follow this protocol to perform amplification of CRISPR pooled plasmid libraries in Escherichia coli ...assumes familiarity with standard bacterial transformation and basic knowledge of the library being amplified...amplified. Please see our protocol on Bacterial Transformation . The generalized pooled library amplification... be performed at the end of the day to ensure that growth times are limited. Day 2: Harvest cells and ...using a new vented falcon tube for every two transformations. Each of the four 14 mL Vented Falcon Tubes...

  2. Immunocytochemistry

    Type
    Protocol
    ... of cold 4% paraformaldehyde in PBS on ice for 15 min . Pro-Tip While 4% Paraformaldehyde fixation works...rocking platform. Permeabilize cells for 10 min at room temperature ( RT ) on a rocking platform in 500...rocking platform. Section 3: Labeling with antibody Block for 20 min at RT on a rocking platform in 500...labeling HeLa cells for a target protein using the formaldehyde fixation method. The protocol may need to be...specific products or equipment. Inclusion of this information is solely for transparency intended to support...Pipette controller Pipette tips and pipettes Rocking platform Tweezers Fluorescent microscope 0.5–10 µL single...coated coverslips HeLa cells 24-well plate 4% Paraformaldehyde 5 mg/mL 4′,6-diamidino-2-phenylindole (DAPI...

  3. Protocol - Over-Agar Antibiotic Plating

    Type
    Protocol
    ...incubation, transform DH5α E. coli cells by heatshock with the plasmid of interest. See our transformation page...for a detailed heatshock transformation protocol. Plate 50 µL of transformed E. coli /rescue media suspension...also like... Making LB Agar Plates Bacterial Transformation Recovering Plasmid DNA from Bacterial Culture...plating antibiotic over-agar for the selection of transformed E. coli . Over-agar spreading of antibiotic makes...investigator to conveniently plate and select transformed cells containing plasmids differing in their ... sterile water (or other antibiotic) E. coli transformed with a plasmid containing the carbenicillin (...for 18 hours. Day 2 Observe plates for colony formation. Shown below are the results from an experiment...

  4. Western Blot

    Type
    Protocol
    ... a shaking platform. Wash the membrane 3x for 5 min in 1X TBST at RT on a shaking platform. Section 6:... a shaking platform. Wash the membrane 3x for 5 min in 1X TBST at RT on a shaking platform. Prepare the...specific products or equipment. Inclusion of this information is solely for transparency intended to support...supply iBlot 2 Gel Transfer Device Roller Spatula Platform shaker Cold room Gel imager -80 °C freezer Reagents...the manufacturer's instructions for additional information specific to your antibody, such as ideal blocking...between antibodies. Refer to the manufacturer's information before running your experiment. Remove the membrane...overnight in primary antibody at 4 °C on a rocking platform. Pro-Tip Primary antibody incubation can be reduced...

  5. Plasmid Cloning by Restriction Enzyme Digest (with Protocols)

    Type
    Protocol
    ...self-ligating recipient plasmid backbone. Transformation Transform your ligation reaction into your bacterial...from your transformation will give you the first indication as to whether your transformation worked. our...Information about plasmid cloning by restriction enzyme digest (subcloning), including design and experimental...Digest of Plasmid DNA DNA Ligation Bacterial Transformation Summary The following technique can be used...in a new window) New England Biolabs for more information about restriction enzyme buffers). If you select...competent cells. For most standard cloning, you can transform 1-2μl of your ligation reaction into competent...conduct a positive control to ensure that your transformation worked. You should also verify that you are...

  6. Protocol - How to Ligate Plasmid DNA

    Type
    Protocol
    ...Digest of Plasmid DNA Bacterial Transformation Background Information The final step in the construction...ligation, is performed by the T4 DNA ligase enzyme. The DNA ligase catalyzes the formation of covalent ...the backbone and the complete plasmid can be transformed into bacterial cells for propagation. The majority...digested vector backbone with a phosphatase before performing the ligation reaction (phosphatase removes the... incubation at 37°C. Proceed with bacterial transformation . Tips and FAQ Do controls When doing ligations...contamination of intact plasmid in ligation or transformation reagents Optimizing the Vector:Insert Ratio...

  7. Adenovirus Guide

    Type
    Guide
    ...consists of two plasmids that eventually recombine to form one: Shuttle/transfer plasmid (e.g. pAdTrack) — ...GFP. Recombinant adenoviral vector (rAdV) Modified form of AdV used to deliver genetic material into cells...of experiments being performed. Your biosafety office can provide more information on your institution'...also made them the most widely used viral vector platform for vaccine design against a diversity of viruses...E1, E4, E2a and VA for replication. For more information about AAVs, read our AAV guide . Recombinant ..., and higher titers. However, the risk of RCA formation is higher for first-generation rAdV vectors than...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene...

  8. Coomassie Purity Stain of Recombinant Antibodies

    Type
    Protocol
    ...specific products or equipment. Inclusion of this information is solely for transparency intended to support...Microcentrifuge Electrophoresis chamber Power supply Rocking platform Fume hood Metal spatula Razor blade Plastic tray...water for 5 min with gentle agitation on a rocking platform. Pour off the water in the sink. Add 20 mL of ...incubate for 1 h with gentle agitation on a rocking platform. Pour off the SimplyBlue SafeStain in the sink...incubate for 1 h with gentle agitation on a rocking platform. Pour off the water in the sink. Add 100 mL of...incubate for 1 h with gentle agitation on a rocking platform. Pour off the water in the sink. Take a brightfield... exported CSV file. Select import. Choose file. Format as needed. Select the Insert tab, then Chart . ...

  9. Protocol - How to Create a Bacterial Glycerol Stock

    Type
    Protocol
    ...Bacterial Transformation Recovering Plasmid DNA from Bacterial Culture Background Information Bacterial... not need to obtain more competent cells and retransform. Bacteria on an LB agar plate can be stored at... temperature, can be found on your plasmid's information page. The next day you will be able to start ...freezing (5-6 times). Make sure that you see one uniform solution, and there are no layers present. Be sure...

  10. Kit Free RNA Extraction

    Type
    Protocol
    ...Follow this protocol to perform RNA extraction without a kit....Water-saturated Phenol 2 M Sodium Acetate pH 4 Chloroform/Isoamyl alcohol (49:1) 75% Ethanol RNase-free...phenol, mix thoroughly by inversion. Add 0.2 mL of Chloroform/Isoamyl alcohol (49:1) and then shake vigorously...Nanodrop), agarose gel, or bioanalyzer. For more information on nucleic acid quantification, see our protocol...from the homogenized sample(s). Add 0.2 mL of Chloroform/Isoamyl alcohol (49:1) per 1 mL of TRIzol® used...

  11. AAV Purification by Iodixanol Gradient Ultracentrifugation

    Type
    Protocol
    ...your purified virus. Nonetheless, we recommend performing a buffer exchange before using the purified AAV...0.001% Poloxamer 188 in PBS + 200 mM NaCl (C) (formulation buffer) Add 5 mL of Buffer B and 2 mL of 5 M ...supernatant on top of the gradient. Use 1X PBS (or formulation buffer) to top off the tube. Seal the QuickSeal...not easily removed. After each spin, add more formulation buffer and sample and make sure to pipet back...is less than 500 µL, bring up the volume with formulation buffer. Use a P1000 to the bottom of the filter...

  12. Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs

    Type
    Protocol
    ...four biosafety levels. This protocol provides information for both biosafety level 1 (BSL-1) and biosafety...to your hand, but not so tight that you cannot perform your duties. Be sure to try out different sizes... and is being shared outside of Addgene for informational purposes only. If you choose to reuse or repurpose... can be held responsible for your use of the information contained in or linked to from these web pages...

  13. Video Library

    Type
    Protocol
    ... tips Bacterial Transformations We walk you through a standard plasmid transformation protocol and offer...tricks to reduce transformation time and increase efficiency Bacterial Transformation Protocol Inoculating...

  14. Lab Safety for Biosafety Levels One and Two

    Type
    Protocol
    ...four biosafety levels. This protocol provides information for both biosafety level 1 (BSL-1) and biosafety...clearly marked as “BSL-2.” The names and contact information of the laboratory manager should be clearly visible... and is being shared outside of Addgene for informational purposes only. If you choose to reuse or repurpose... can be held responsible for your use of the information contained in or linked to from these web pages...

  15. Using a Light Microscope Protocol

    Type
    Protocol
    ... are multiple objective lenses. Each objective performs essentially the same task but has different magnifying...an objective, you will see several pieces of information, but the most important (for now) is the magnification..., any stains used in your sample, and sample information so that you or others can interpret your images...scratches, and dust can easily impair microscope performance. Be sure to clean up your work area and microscope...

  16. Plasmid Modification by Annealed Oligo Cloning (with Protocols)

    Type
    Protocol
    ...Digest of Plasmid DNA DNA Ligation Bacterial Transformation Summary Oligo overlap cloning can be used anytime...that can be added when ordering them or can be performed enzymatically later. Experimental Procedure Digest...the vector with 0.75-6 ng of annealed oligos). Transform 2-3μL into your favorite competent bacteria and...

  17. Protocols for Molecular Biology, Plasmid Cloning, and Viral Preps

    Type
    Protocol
    ... the Video! DNA Purification Miniprep, phenol-chloroform extract, and precipitate DNA DNA Quantification...Ligation Assemble DNA using DNA ligase Bacterial Transformation Introduce DNA into a bacterial strain Watch... virus using fluorescence measurements Colony Formation Titering Assay for Lentivirus Quantify virus by...

  18. Transfection for Recombinant Antibodies

    Type
    Protocol
    ...specific products or equipment. Inclusion of this information is solely for transparency intended to support... counter 37 °C, 5% CO 2 incubator with shaking platform set to 120 rpm 37 °C bead bath Vortex Stir bar...flask.Incubate in a 37 °C, 5% CO 2 incubator on a shaking platform set to 120 rpm. Pro-Tip Do not use cells that ...

  19. Affinity Purification of Recombinant Antibodies with Protein A or Protein G

    Type
    Protocol
    ...specific products or equipment. Inclusion of this information is solely for transparency intended to support...spectrophotometer 37 °C, 5% CO 2 incubator with shaking platform set to 120 rpm 37 °C bead bath Clamp stand and...divide the sample among multiple columns. For information about the total binding capacity for your columns...

  20. Sequencing Primers

    Type
    Guide
    ...Forward SFFV-F ATTGATTGACTGCCCACCTC Spleen focus forming virus 5' LTR Forward SP6 ATTTAGGTGACACTATAG SP6...Email us at [email protected] . For additional information on molecular biology, plasmids, and recombinant...
Showing: 921 - 940 of 965 results