Skip to main content
Addgene

We narrowed to 960 results for: form

Showing: 921 - 940 of 960 results
  1. Plasmid Cloning by Restriction Enzyme Digest (with Protocols)

    Type
    Protocol
    ...self-ligating recipient plasmid backbone. Transformation Transform your ligation reaction into your bacterial...from your transformation will give you the first indication as to whether your transformation worked. our...Information about plasmid cloning by restriction enzyme digest (subcloning), including design and experimental...Digest of Plasmid DNA DNA Ligation Bacterial Transformation Summary The following technique can be used...in a new window) New England Biolabs for more information about restriction enzyme buffers). If you select...competent cells. For most standard cloning, you can transform 1-2μl of your ligation reaction into competent...conduct a positive control to ensure that your transformation worked. You should also verify that you are...
  2. Protocol - How to Ligate Plasmid DNA

    Type
    Protocol
    ...Digest of Plasmid DNA Bacterial Transformation Background Information The final step in the construction...ligation, is performed by the T4 DNA ligase enzyme. The DNA ligase catalyzes the formation of covalent ...the backbone and the complete plasmid can be transformed into bacterial cells for propagation. The majority...digested vector backbone with a phosphatase before performing the ligation reaction (phosphatase removes the... incubation at 37°C. Proceed with bacterial transformation . Tips and FAQ Do controls When doing ligations...contamination of intact plasmid in ligation or transformation reagents Optimizing the Vector:Insert Ratio...
  3. Coomassie Purity Stain of Recombinant Antibodies

    Type
    Protocol
    ...specific products or equipment. Inclusion of this information is solely for transparency intended to support...Microcentrifuge Electrophoresis chamber Power supply Rocking platform Fume hood Metal spatula Razor blade Plastic tray...water for 5 min with gentle agitation on a rocking platform. Pour off the water in the sink. Add 20 mL of ...incubate for 1 h with gentle agitation on a rocking platform. Pour off the SimplyBlue SafeStain in the sink...incubate for 1 h with gentle agitation on a rocking platform. Pour off the water in the sink. Add 100 mL of...incubate for 1 h with gentle agitation on a rocking platform. Pour off the water in the sink. Take a brightfield... exported CSV file. Select import. Choose file. Format as needed. Select the Insert tab, then Chart . ...
  4. Protocol - How to Create a Bacterial Glycerol Stock

    Type
    Protocol
    ...Bacterial Transformation Recovering Plasmid DNA from Bacterial Culture Background Information Bacterial... not need to obtain more competent cells and retransform. Bacteria on an LB agar plate can be stored at... temperature, can be found on your plasmid's information page. The next day you will be able to start ...freezing (5-6 times). Make sure that you see one uniform solution, and there are no layers present. Be sure...
  5. Kit Free RNA Extraction

    Type
    Protocol
    ...Follow this protocol to perform RNA extraction without a kit....Water-saturated Phenol 2 M Sodium Acetate pH 4 Chloroform/Isoamyl alcohol (49:1) 75% Ethanol RNase-free...phenol, mix thoroughly by inversion. Add 0.2 mL of Chloroform/Isoamyl alcohol (49:1) and then shake vigorously...Nanodrop), agarose gel, or bioanalyzer. For more information on nucleic acid quantification, see our protocol...from the homogenized sample(s). Add 0.2 mL of Chloroform/Isoamyl alcohol (49:1) per 1 mL of TRIzol® used...
  6. Sequencing Primers

    Type
    Guide
    ...primer SFFV-F ATTGATTGACTGCCCACCTC Spleen focus forming virus 5' LTR, forward primer SP6 ATTTAGGTGACACTATAG...available for your convenience. For reference information, please consult Addgene's Molecular Biology Reference...
  7. AAV Purification by Iodixanol Gradient Ultracentrifugation

    Type
    Protocol
    ...your purified virus. Nonetheless, we recommend performing a buffer exchange before using the purified AAV....001% Pluronic-F68 in PBS + 200 mM NaCl (C) (formulation buffer) Add 5 mL of Buffer B and 2 mL of 5 M ...supernatant on top of the gradient. Use 1X PBS (or formulation buffer) to top off the tube. Seal the QuickSeal...not easily removed. After each spin, add more formulation buffer and sample and make sure to pipet back...is less than 500 µL, bring up the volume with formulation buffer. Use a P1000 to the bottom of the filter...
  8. Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs

    Type
    Protocol
    ...four biosafety levels. This protocol provides information for both biosafety level 1 (BSL-1) and biosafety...to your hand, but not so tight that you cannot perform your duties. Be sure to try out different sizes... and is being shared outside of Addgene for informational purposes only. If you choose to reuse or repurpose... can be held responsible for your use of the information contained in or linked to from these web pages...
  9. Video Library

    Type
    Protocol
    ... tips Bacterial Transformations We walk you through a standard plasmid transformation protocol and offer...tricks to reduce transformation time and increase efficiency Bacterial Transformation Protocol Inoculating...
  10. Lab Safety for Biosafety Levels One and Two

    Type
    Protocol
    ...four biosafety levels. This protocol provides information for both biosafety level 1 (BSL-1) and biosafety...clearly marked as “BSL-2.” The names and contact information of the laboratory manager should be clearly visible... and is being shared outside of Addgene for informational purposes only. If you choose to reuse or repurpose... can be held responsible for your use of the information contained in or linked to from these web pages...
  11. Using a Light Microscope Protocol

    Type
    Protocol
    ... are multiple objective lenses. Each objective performs essentially the same task but has different magnifying...an objective, you will see several pieces of information, but the most important (for now) is the magnification..., any stains used in your sample, and sample information so that you or others can interpret your images...scratches, and dust can easily impair microscope performance. Be sure to clean up your work area and microscope...
  12. Cloning

    Type
    Guide
    ...repetitive sequences and DNA that ends in sequences that form complex secondary structues. You can view an example...guide on molecular cloning techniques, including information on seven commonly used cloning methods. Molecular...need for restriction enzyme cloning. For more information and tips check out our Plasmid 101 blog post ...nicks that are repaired by the bacteria after transformation. LIC does not require site-specific recombination... is rendered unnecessary. The product may be transformed directly into E. coli , where the nicks will ...than 10kb. Another advantage is the ability to perform oligonucleotide stitching, in which pieces of DNA...disadvantage is that you need to be set up to grow, transform and purify DNA from yeast. Back to Top...
  13. CRISPR Guide

    Type
    Guide
    ...ll express your gRNA and Cas9 protein, which will form a ribonucleoprotein complex through interactions...effector, composed of several separate Cas enzymes that form a complex called Cascade (see Cas3 for more details...with Cas3 Rather than initiating DNA cleavage to form a break, Cas3 initiates single-strand DNA degradation...dCas9 Nuclease dead Cas9, an enzymatically inactive form of Cas9; can bind, but cannot cleave DNA DSB D ouble...Cas9 undergoes a second conformational change upon target binding. In this formation, its nuclease domains...detection platform. Based on this non-specific cleavage, a Cas13a-based molecular detection platform, termed...positively-charged grooves on Cas9. gRNA binding induces a conformational change in Cas9, shifting it into an active,...
  14. Plasmid Modification by Annealed Oligo Cloning (with Protocols)

    Type
    Protocol
    ...Digest of Plasmid DNA DNA Ligation Bacterial Transformation Summary Oligo overlap cloning can be used anytime...that can be added when ordering them or can be performed enzymatically later. Experimental Procedure Digest...the vector with 0.75-6 ng of annealed oligos). Transform 2-3μL into your favorite competent bacteria and...
  15. Plan Your Experiment

    Type
    Guide
    ...protein and in vitro transcribed gRNA are combined to form a Cas9-gRNA complex, which is delivered to cells... be used to examine off-target effects. More information on each of these techniques can be found in our...
  16. Protocols for Molecular Biology, Plasmid Cloning, and Viral Preps

    Type
    Protocol
    ... the Video! DNA Purification Miniprep, phenol-chloroform extract, and precipitate DNA DNA Quantification...Ligation Assemble DNA using DNA ligase Bacterial Transformation Introduce DNA into a bacterial strain Watch... virus using fluorescence measurements Colony Formation Titering Assay for Lentivirus Quantify virus by...
  17. Transfection for Recombinant Antibodies

    Type
    Protocol
    ...specific products or equipment. Inclusion of this information is solely for transparency intended to support... counter 37 °C, 5% CO 2 incubator with shaking platform set to 120 rpm 37 °C bead bath Vortex Stir bar...flask.Incubate in a 37 °C, 5% CO 2 incubator on a shaking platform set to 120 rpm. Pro-Tip Do not use cells that ...
  18. Affinity Purification of Recombinant Antibodies with Protein A or Protein G

    Type
    Protocol
    ...specific products or equipment. Inclusion of this information is solely for transparency intended to support...spectrophotometer 37 °C, 5% CO 2 incubator with shaking platform set to 120 rpm 37 °C bead bath Clamp stand and...divide the sample among multiple columns. For information about the total binding capacity for your columns...
  19. Protocol - How to Purify DNA from an Agarose Gel

    Type
    Protocol
    ... Gel Electrophoresis DNA Ligation Background Information Gel purification allows you to isolate and purify...step with the now gel purified DNA. Find more information about DNA quantification here . Tips and FAQ ...
Showing: 921 - 940 of 960 results