We narrowed to 957 results for: Cre
-
TypeBlog Post...detected in the same way. The standard curve that is created from the OD and concentration of the known samples...
-
Optogenetics Guide
TypeGuide...combined with site specific recombinase technology like Cre-lox, which allows you to express an opsin ONLY in...using a viral vector with a floxed opsin in a VGAT-cre animal will result in expression of the opsin only...Alternatively, when one half of a given protein, such as the Cre recombinase, is fused to Cry2 and the other half .... Novel recombinant adeno-associated viruses for Cre activated and inactivated transgene expression in... include: Increased photocurrent amplitude Examples: ChR2(H134R), C1V1(t/t), ChIEF Increased channel (... following enhancements: Increased light sensitivity Example: ArchT Increased photocurrent amplitude Examples...Scherffelia dubia ). Synthetic variants have been created via genetic point mutations, codon optimization... -
Sequencing Primers
TypeGuide...early promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase, reverse primer CYC1... -
Chemogenetics Guide
TypeGuide... FLEx vectors block expression in the absence of Cre and are especially useful in AAV experiments where...reporter remains silent until a cell or tissue-specific Cre is provided. Want to know more about FLEx vectors... G-protein and activate neuronal signaling by increasing intracellular cAMP concentrations. There is currently... currently one Gs-DREADD, rM3D, that was created by replacing the corresponding intracellular region of...(R165L) Human M3 muscarinic Arrestin-2/-3 CNO* Increase Arrestin translocation Arrestin signalling Nakajima...hM3Dq hM1Dq hM5Dq Human M3 muscarinic G αq CNO* Increase Ca 2+ Neuronal burst firing Armbruster et al.,...M3 muscarinic & turkey β1-adrenergic G αs CNO* Increase cAMP Neuronal burst firing Guettier et al., 2009... -
Adenovirus Guide
TypeGuide...contamination have been developed, such as using the Cre-lox and Flp-FRT recombination systems to excise the...adenoviral production, and is driven by use of the Cre recombinase. Genome Integration Upon infection, wild-type... forward or reverse orientation, respectively. Created with BioRender.com. Adenoviruses are part of the...adenoviruses have been modified by researchers to create recombinant adenoviral (rAdV) vectors in order ...deletions. Figure 2: First-generation rAdV vectors. Created with BioRender.com. Second-generation rAdV vectors...with first-generation rAdV vectors and further increase the transgene packaging capacity up to ~10.5 kb...vectors. Figure 3: Second-generation rAdV vectors. Created with BioRender.com. Third-generation rAdV vectors... -
CRISPR Guide
TypeGuide...used for large scale edits. These proteins, like Cre recombinase or phage derived serine integrases, insert... GAT; increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease...others work to increase Cas9’s proofreading capabilities. No matter the method, increased fidelity enzymes...backbone HypaCas9 - increase Cas9 proofreading and discrimination evoCas9 - decrease off-target effects...domains to expand PAM recognition, increase specificity, and decrease off-target effects Sniper-Cas9 - ...compatible with truncated gRNAs to increase specificity SuperFi-Cas9 - increases fidelity with reduced nuclease...integration of donor DNA. Genome-Wide Screens Using CRISPR In a genetic screen, a population of cells with mutations... -
Guide to Using Pooled Libraries
TypeGuide...Negative Screen Negative screens are a little trickier than positive screens. In a negative screen, the goal...plasmid. Library screens can be divided into two types: positive screens and negative screens. Both types ...reproducibility. Types of Pooled Library Screens In pooled library screens, cells are infected at a very low ... cells. DIVERGE: Positive and negative screens POSITIVE screen: Apply library Apply selection Most cells... of the selection mechanism Positive Screen In a positive screen, the goal is to identify those cells ...been depleted by selection. In a CRISPR screen, negative screens are often used to identify genes that ...Knockout Screening Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional Screens New... -
Lentiviral Vector Guide
TypeGuide...transgene expression. Popular uses include Cre-lox mice, knockouts using CRISPR or shRNA , and overexpressing...removed or mutated for increased safety. Figure 1: Wild-type lentivirus genome. Created with BioRender.com...in-stock lentiviral preps . CRISPR Genomic Screens Genome-wide screens are an efficient way to determine what... use the packaging genes gag , pol , and env to create viral particles. Wild-type lentiviruses additionally...replication-competent lentivirus production — that is, creation of viral particles that could infect cells and...Figure 2: First-generation lentiviral plasmids. Created with BioRender.com. Second-generation Second-generation...Figure 3: Second-generation lentiviral plasmids. Created with BioRender.com. Third-generation The third-... -
Plan Your Experiment
TypeGuide...mutant allele of a gene ( point mutant )? Increase or decrease expression of a target gene? Once you have...High-fidelity Cas enzymes increase specificity. Dual-nickase approach increases specificity but is less ...efficiency. In fact, cleavage efficiency may increase or decrease depending upon the specific nucleotides ...alone for mammalian cell lines. Activate (CRISPRa) Increase expression of an endogenous gene(s) without permanently...vivo A common choice for conducting genome-wide screens using CRISPR AAV transduction CRISPR elements are...Transient expression of CRISPR components Expression decreases as RNA is degraded within the cell Short window...window of CRISPR component expression may decrease off-target effects Can be used to generate transgenic ... -
Adeno-associated virus (AAV) Guide
TypeGuide...under strong neuron-specific promoters or neural Cre-dependent expression, to visualize connections between... hybrid capsids, and capsids created through directed evolution. Created with BioRender.com. Common Uses...for packaging. Figure 1: Wild-type AAV genome. Created with BioRender.com. AAVs are part of the Dependoparvovirus...-type AAVs have been modified by researchers to create recombinant adeno-associated viral (rAAV) vectors... Plasmids required for rAAV vector production. Created with BioRender.com. AAV Vector Production Cloning... Figure 3: Overview of rAAV vector production. Created with BioRender.com. Genome Integration Recombinant...it is likely that this number will continue to increase. This diversity makes rAAV vectors a very useful... -
Cloning
TypeGuide...the gap created by the 5’ exonuclease and finally ligase seals the nicks in the DNA to create one piece...Cloning Oligo Stitching Molecular cloning or the creation of recombinant DNA is an essential process used...several of the most popular cloning methods used to create recombinant DNA. Restriction Enzyme Cloning Restriction...compatible attP sites via a proprietary BP clonase (creating an entry clone). The entry clone now has recombined...restriction enzymes or an exogenous ligase providing an incredibly quick and easy way to clone a fresh PCR product...available TOPO® ready, and it is not feasible to create a TOPO® vector yourself. Additionally, the efficiency...distal to their recognition site allows for the creation of custom overhangs, which is not possible with... -
Antibody Guide
TypeGuide... cell cultures using hybridomas, cell cultures created by fusing B cells with myeloma cells (immortalized...immortalized B cells). The genetic reorganization that creates variety in the antibody allowing for their extreme...animals immunized as described above are used to create hybridomas, which produce large amounts of a single...recombinant antibodies. Recombinant antibodies are created by cloning antibody genes from specific hybridoma...goes through a randomized reorganization process, creating a unique binding site. This process, known as ...roles in the immune response, and can be used to increase flexibility or specificity in antibody-based methods... Valency Subclasses IgA Prevalent antibody in secretions (e.g. tears, saliva, mucus) where it protects... -
Gamma-Retroviral Vector Guide
TypeGuide...scientists have made changes to these components for increased safety when producing viral vectors in a laboratory.... Figure 1: Wild-type gamma-retrovirus genome. Created with BioRender.com. All gamma-retroviral vectors...distinct plasmids for safety to reduce the chance of creating replication-competent retroviruses. For a summary...tropism). Figure 2: Gamma-retroviral plasmids. Created with BioRender.com. Gamma-Retroviral Vector Production... 3: Gamma-retroviral vector packaging methods. Created with BioRender.com. Viral Vector Integration Much...genome and the cells that survive can be expanded to create stable cell lines. The cell lines will have the...transcription. Removal of this region in the 3’ LTR creates self-inactivating viral vectors. R in cis Repeat... -
Molecular Biology Reference
TypeGuide...study DNA fragments of interest, such as genes. Creation of recombinant DNA Molecular Cloning Plasmids ... With current cloning technology, it is easy to create and modify plasmids containing the genetic element...vector can also include an enhancer sequence which increases the amount of protein or RNA produced. Expression...into target cells. You can use these plasmids to create viral particles, such as lentiviral, retroviral...used in place of ampicillin. Preparing Antibiotics Create a stock solution of your antibiotic. Unless otherwise... -
Educational Resources
TypeGuide...Electrophoresis Bacterial Transformation Plasmid Cloning Creating Bacterial Glycerol Stocks Restriction Digests ... -
Science Guides
TypeGuide... Science Guides Addgene has created the following guides to help you start learning... -
Addgene's eBook Collection
TypeGuide...and how to use pooled libraries in genome-wide screens. Close About Overlay Select Fluorescent Proteins...