Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 967 results for: Cre

Showing: 941 - 960 of 967 results

  4. A Control for All Seasons

    Type
    Blog Post
    ...technical replicates or repeated measurements will increase the power of the results. In this case, mouse ...

  11. Optogenetics Guide

    Type
    Guide
    ...combined with site specific recombinase technology like Cre-lox, which allows you to express an opsin ONLY in...using a viral vector with a floxed opsin in a VGAT-cre animal will result in expression of the opsin only...Alternatively, when one half of a given protein, such as the Cre recombinase, is fused to Cry2 and the other half .... Novel recombinant adeno-associated viruses for Cre activated and inactivated transgene expression in... include: Increased photocurrent amplitude Examples: ChR2(H134R), C1V1(t/t), ChIEF Increased channel (... following enhancements: Increased light sensitivity Example: ArchT Increased photocurrent amplitude Examples...Scherffelia dubia ). Synthetic variants have been created via genetic point mutations, codon optimization...

  12. Sequencing Primers

    Type
    Guide
    ...early promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase, reverse primer CYC1...

  13. Chemogenetics Guide

    Type
    Guide
    ... FLEx vectors block expression in the absence of Cre and are especially useful in AAV experiments where...reporter remains silent until a cell or tissue-specific Cre is provided. Want to know more about FLEx vectors... G-protein and activate neuronal signaling by increasing intracellular cAMP concentrations. There is currently... currently one Gs-DREADD, rM3D, that was created by replacing the corresponding intracellular region of...(R165L) Human M3 muscarinic Arrestin-2/-3 CNO* Increase Arrestin translocation Arrestin signalling Nakajima...hM3Dq hM1Dq hM5Dq Human M3 muscarinic G αq CNO* Increase Ca 2+ Neuronal burst firing Armbruster et al.,...M3 muscarinic & turkey β1-adrenergic G αs CNO* Increase cAMP Neuronal burst firing Guettier et al., 2009...

  14. Adenovirus Guide

    Type
    Guide
    ...contamination have been developed, such as using the Cre-lox and Flp-FRT recombination systems to excise the...adenoviral production, and is driven by use of the Cre recombinase. Genome Integration Upon infection, wild-type... forward or reverse orientation, respectively. Created with BioRender.com. Adenoviruses are part of the...adenoviruses have been modified by researchers to create recombinant adenoviral (rAdV) vectors in order ...deletions. Figure 2: First-generation rAdV vectors. Created with BioRender.com. Second-generation rAdV vectors...with first-generation rAdV vectors and further increase the transgene packaging capacity up to ~10.5 kb...vectors. Figure 3: Second-generation rAdV vectors. Created with BioRender.com. Third-generation rAdV vectors...

  15. CRISPR Guide

    Type
    Guide
    ...used for large scale edits. These proteins, like Cre recombinase or phage derived serine integrases, insert... GAT; increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease...others work to increase Cas9’s proofreading capabilities. No matter the method, increased fidelity enzymes...backbone HypaCas9 - increase Cas9 proofreading and discrimination evoCas9 - decrease off-target effects...domains to expand PAM recognition, increase specificity, and decrease off-target effects Sniper-Cas9 - ...compatible with truncated gRNAs to increase specificity SuperFi-Cas9 - increases fidelity with reduced nuclease...integration of donor DNA. Genome-Wide Screens Using CRISPR In a genetic screen, a population of cells with mutations...

  16. Guide to Using Pooled Libraries

    Type
    Guide
    ...Negative Screen Negative screens are a little trickier than positive screens. In a negative screen, the goal...plasmid. Library screens can be divided into two types: positive screens and negative screens. Both types ...reproducibility. Types of Pooled Library Screens In pooled library screens, cells are infected at a very low ... cells. DIVERGE: Positive and negative screens POSITIVE screen: Apply library Apply selection Most cells... of the selection mechanism Positive Screen In a positive screen, the goal is to identify those cells ...been depleted by selection. In a CRISPR screen, negative screens are often used to identify genes that ...Knockout Screening Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional Screens New...

  17. Lentiviral Vector Guide

    Type
    Guide
    ...transgene expression. Popular uses include Cre-lox mice, knockouts using CRISPR or shRNA , and overexpressing...removed or mutated for increased safety. Figure 1: Wild-type lentivirus genome. Created with BioRender.com...in-stock lentiviral preps . CRISPR Genomic Screens Genome-wide screens are an efficient way to determine what... use the packaging genes gag , pol , and env to create viral particles. Wild-type lentiviruses additionally...replication-competent lentivirus production — that is, creation of viral particles that could infect cells and...Figure 2: First-generation lentiviral plasmids. Created with BioRender.com. Second-generation Second-generation...Figure 3: Second-generation lentiviral plasmids. Created with BioRender.com. Third-generation The third-...

  18. Plan Your Experiment

    Type
    Guide
    ... mutant allele of a gene (point mutant)? Increase or decrease expression of a target gene? Once you have...High-fidelity Cas enzymes increase specificity Dual-nickase approach increases specificity but is less ...efficiency. In fact, cleavage efficiency may increase or decrease depending upon the specific nucleotides ... the general framework of a CRISPR experiment. Created with BioRender.com. Select Your Desired Genetic...mammalian cell lines Interfere Activate (CRISPRa) Increase gene expression without permanently modifying ...likely won’t be able to completely avoid them. To increase specificity, consider using an engineered Cas ...target in your samples to ensure there are no discrepancies with the reference sequence you used for gRNA...

  19. Modular Cloning Guide

    Type
    Guide
    ...) to optimize secretion and cell surface display of proteins of interest. Yeast Secrete and Detect Yeast...It is a powerful and very efficient method for creating many plasmids from different combinations of a... directionally assembled into a Level 1 vector creating a single transcriptional unit (for example, a ...Combining multiple Level 2 vectors permits the creation of even more complex constructs constrained only...for cloning and assembling standardized parts to create eukaryotic multigene constructs. MoClo Plant Parts...System Plant Expression Jan Lohmann 56 plasmids to create plant expression vectors containing several cassettes...with additional Level 0 modules and components to create plasmids with multiple transcriptional units. MultiGreen...

  20. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...under strong neuron-specific promoters or neural Cre-dependent expression, to visualize connections between... hybrid capsids, and capsids created through directed evolution. Created with BioRender.com. Common Uses...for packaging. Figure 1: Wild-type AAV genome. Created with BioRender.com. AAVs are part of the Dependoparvovirus...-type AAVs have been modified by researchers to create recombinant adeno-associated viral (rAAV) vectors... Plasmids required for rAAV vector production. Created with BioRender.com. AAV Vector Production Cloning... Figure 3: Overview of rAAV vector production. Created with BioRender.com. Genome Integration Recombinant...it is likely that this number will continue to increase. This diversity makes rAAV vectors a very useful...
Showing: 941 - 960 of 967 results