Skip to main content

We narrowed to 967 results for: Cre

Showing: 941 - 960 of 967 results
  1. A Control for All Seasons

    Type
    Blog Post
    ...technical replicates or repeated measurements will increase the power of the results. In this case, mouse ...
  2. Sequencing Primers

    Type
    Guide
    ...immediate early promoter Forward CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC...
  3. Optogenetics Guide

    Type
    Guide
    ...if one fragment of a protein of interest, such as Cre recombinase, is fused to Cry2 and the other fragment...combined with site-specific recombinase systems like Cre-lox , which allows you to express an opsin only in...using a viral vector with a floxed opsin in a VGAT-Cre animal will result in expression of the opsin only...Scherffelia dubia ). Synthetic variants have been created via genetic point mutations, codon optimization...Anion-conducting ChR variants that inhibit neurons have been created and identified in other species. By acting as light-gated...amplitude 490 ChR/T159C T159C mutation; displays increased photocurrents 470 SFO/SSFO Step Function Opsins...noctigama ; ChrimsonR carries K176R mutation with increased on/off kinetics 590 ChRmine Red-shifted channelrhodopsin...
  4. Chemogenetics Guide

    Type
    Guide
    ... FLEx vectors block expression in the absence of Cre and are especially useful in AAV experiments where...reporter remains silent until a cell or tissue-specific Cre is provided. Download our chemogenetics poster: References... G-protein and activate neuronal signaling by increasing intracellular cAMP concentrations. There is currently... currently one Gs-DREADD, rM3D, that was created by replacing the corresponding intracellular region of...Rq(R165L) Human M3 muscarinic Arrestin-2/-3 DCZ Increase Arrestin translocation Arrestin signalling Nakajima...hM3Dq hM1Dq hM5Dq Human M3 muscarinic G αq DCZ Increase Ca 2+ Neuronal burst firing Armbruster et al.,... M3 muscarinic & turkey β1-adrenergic G αs DCZ Increase cAMP Neuronal burst firing Guettier et al., 2009...
  5. Adenovirus Guide

    Type
    Guide
    ...contamination have been developed, such as using the Cre-lox and Flp-FRT recombination systems to excise the...adenoviral production, and is driven by use of the Cre recombinase. Genome Integration Upon infection, wild-type...Scientific Curation team at Addgene. Media Credits Figures created with BioRender (Link opens in a new window...Uses Safety Resources Plasmid Elements Glossary Credits Adenoviruses (AdV) are medium-sized, non-enveloped...adenoviruses have been modified by researchers to create recombinant adenoviral (rAdV) vectors in order ...with first-generation rAdV vectors and further increase the transgene packaging capacity up to ~10.5 kb...Vogelstein’s lab , is the most popular method for creating first-generation rAdV vectors, which is still ...
  6. Molecular Biology Reference

    Type
    Guide
    ...CRISPR check out our CRISPR Guide . CRISPR Plasmids , Cre-lox and Other Recombinases , TALEN Plasmids and Kits... into a right-handed, double-stranded helix. To create the double helix, the nucleotides on the opposing...fragments of interest, such as genes. Figure 1: Creation of recombinant DNA. Working with Plasmids Today... With current cloning technology, it is easy to create and modify plasmids containing the genetic element...vector can also include an enhancer sequence which increases the amount of protein or RNA produced. Expression...into target cells. You can use these plasmids to create viral particles (most commonly lentiviral, retroviral...method. Figure 3: Summary of Sanger sequencing. Created with BioRender.com. Next-generation Sequencing ...
  7. Lentiviral Vector Guide

    Type
    Guide
    ...transgene expression. Popular uses include Cre-lox mice, knockouts using CRISPR or shRNA , and overexpressing...in-stock lentiviral preps . CRISPR Genomic Screens Genome-wide screens are an efficient way to determine what...Scientific Curation team at Addgene. Media Credits Figures created with BioRender (Link opens in a new window...Uses Safety Resources Plasmid Elements Glossary Credits Lentiviruses are a type of retrovirus and belong...laboratory, and many have been removed or mutated for increased safety. Figure 1: Wild-type lentivirus genome.... use the packaging genes gag , pol , and env to create viral particles. Wild-type lentiviruses additionally...replication-competent lentivirus production — that is, creation of viral particles that could infect cells and...
  8. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...under strong neuron-specific promoters or neural Cre-dependent expression, to visualize connections between...Scientific Curation team at Addgene. Media Credits Figures created with BioRender (Link opens in a new window...Uses Safety Resources Plasmid Elements Glossary Credits Adeno-Associated Viruses (AAV) are small, non-enveloped...-type AAVs have been modified by researchers to create recombinant adeno-associated viral (rAAV) vectors...it is likely that this number will continue to increase. This diversity makes rAAV vectors a very useful...AAV8, AAV9 Kidney AAV8 Liver AAV8, AAV9 Lung AAV6 Pancreas AAV2, AAV8 Photoreceptor cells AAV2, AAV5, AAV8...towards specific cell types of interest has been to create and test capsid libraries with random mutations...
  9. CRISPR Guide

    Type
    Guide
    ...used for large scale edits. These proteins, like Cre recombinase or phage derived serine integrases, insert...GAT; increased nuclease fidelity SpCas9-NG — NG; increased in vitro activity SpG — NGN; increased nuclease...others work to increase Cas9’s proofreading capabilities. No matter the method, increased fidelity enzymes...backbone HypaCas9 — increase Cas9 proofreading and discrimination evoCas9 — decrease off-target effects...domains to expand PAM recognition, increase specificity, and decrease off-target effects Sniper-Cas9 — ...compatible with truncated gRNAs to increase specificity SuperFi-Cas9 — increases fidelity with reduced nuclease...integration of donor DNA. Genome-Wide Screens Using CRISPR In a genetic screen, a population of cells with mutations...
  10. Guide to Using Pooled Libraries

    Type
    Guide
    ...lentiviral or DNA-based screens. Created with BioRender.com. Types of Pooled Library Screens In pooled lentiviral...plasmid. Library screens can be divided into two types: positive screens and negative screens. Both types ...mechanism Negative screens are a little trickier than positive screens. In a negative screen, the goal is to...Library Screening Resources Pooled libraries represent a powerful tool for forward genetic screening or identifying...In a CRISPR screening experiment, target cells are treated with the pooled library to create a population...mutant cells that are then screened for a phenotype of interest. Screening experiments using a pooled ... also useful for loss-of-function screens, gain-of-function screens, enhancer/promoter mapping, and variant...
  11. Molecular Cloning Techniques

    Type
    Guide
    ... the gap created by the 5’ exonuclease. Finally, ligase seals the nicks in the DNA to create one piece... Stitching Resources Molecular cloning, or the creation of recombinant DNA, is an essential process used...several of the most popular cloning methods for the creation of recombinant DNA. Restriction Enzyme Cloning... of interest (insert) into a plasmid backbone. Created with BioRender.com. Gateway Recombination Cloning...compatible attP sites via a proprietary BP clonase, creating an entry clone. The entry clone now has recombined...blog post . Figure 2: Summary of Gateway cloning. Created with BioRender.com. TOPO Cloning Toposiomerase-... enzymes or an exogenous ligase, providing an incredibly quick and easy way to clone a fresh PCR product...
  12. Plan Your Experiment

    Type
    Guide
    ... mutant allele of a gene (point mutant)? Increase or decrease expression of a target gene? Once you have...High-fidelity Cas enzymes increase specificity Dual-nickase approach increases specificity but is less ...efficiency. In fact, cleavage efficiency may increase or decrease depending upon the specific nucleotides ... the general framework of a CRISPR experiment. Created with BioRender.com. Select Your Desired Genetic...mammalian cell lines Interfere Activate (CRISPRa) Increase gene expression without permanently modifying ...likely won’t be able to completely avoid them. To increase specificity, consider using an engineered Cas ...target in your samples to ensure there are no discrepancies with the reference sequence you used for gRNA...
Showing: 941 - 960 of 967 results