Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 969 results for: Cre

Showing: 941 - 960 of 969 results

  5. A Control for All Seasons

    Type
    Blog Post
    ...technical replicates or repeated measurements will increase the power of the results. In this case, mouse ...

  12. Optogenetics Guide

    Type
    Guide
    ...combined with site specific recombinase technology like Cre-lox, which allows you to express an opsin ONLY in...using a viral vector with a floxed opsin in a VGAT-cre animal will result in expression of the opsin only...Alternatively, when one half of a given protein, such as the Cre recombinase, is fused to Cry2 and the other half ... include: Increased photocurrent amplitude Examples: ChR2(H134R), C1V1(t/t), ChIEF Increased channel (... following enhancements: Increased light sensitivity Example: ArchT Increased photocurrent amplitude Examples...Scherffelia dubia ). Synthetic variants have been created via genetic point mutations, codon optimization...Alternatively, ChR variants that inhibit neurons have been created and identified in other species. By acting as light-gated...

  13. Sequencing Primers

    Type
    Guide
    ...immediate early promoter Forward CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC...

  14. Chemogenetics Guide

    Type
    Guide
    ... FLEx vectors block expression in the absence of Cre and are especially useful in AAV experiments where...reporter remains silent until a cell or tissue-specific Cre is provided. Download our chemogenetics poster: References... G-protein and activate neuronal signaling by increasing intracellular cAMP concentrations. There is currently... currently one Gs-DREADD, rM3D, that was created by replacing the corresponding intracellular region of...(R165L) Human M3 muscarinic Arrestin-2/-3 CNO* Increase Arrestin translocation Arrestin signalling Nakajima...hM3Dq hM1Dq hM5Dq Human M3 muscarinic G αq CNO* Increase Ca 2+ Neuronal burst firing Armbruster et al.,...M3 muscarinic & turkey β1-adrenergic G αs CNO* Increase cAMP Neuronal burst firing Guettier et al., 2009...

  15. Adenovirus Guide

    Type
    Guide
    ...contamination have been developed, such as using the Cre-lox and Flp-FRT recombination systems to excise the...adenoviral production, and is driven by use of the Cre recombinase. Genome Integration Upon infection, wild-type... forward or reverse orientation, respectively. Created with BioRender.com. Adenoviruses are part of the...adenoviruses have been modified by researchers to create recombinant adenoviral (rAdV) vectors in order ...deletions. Figure 2: First-generation rAdV vectors. Created with BioRender.com. Second-generation rAdV vectors...with first-generation rAdV vectors and further increase the transgene packaging capacity up to ~10.5 kb...vectors. Figure 3: Second-generation rAdV vectors. Created with BioRender.com. Third-generation rAdV vectors...

  16. Molecular Biology Reference

    Type
    Guide
    ...CRISPR check out our CRISPR Guide . CRISPR Plasmids , Cre-lox and Other Recombinases , TALEN Plasmids and Kits... into a right-handed, double-stranded helix. To create the double helix, the nucleotides on the opposing...fragments of interest, such as genes. Figure 1: Creation of recombinant DNA. Working with Plasmids Today... With current cloning technology, it is easy to create and modify plasmids containing the genetic element...vector can also include an enhancer sequence which increases the amount of protein or RNA produced. Expression...into target cells. You can use these plasmids to create viral particles (most commonly lentiviral, retroviral...method. Figure 3: Summary of Sanger sequencing. Created with BioRender.com. Next-generation Sequencing ...

  17. Lentiviral Vector Guide

    Type
    Guide
    ...transgene expression. Popular uses include Cre-lox mice, knockouts using CRISPR or shRNA , and overexpressing...removed or mutated for increased safety. Figure 1: Wild-type lentivirus genome. Created with BioRender.com...in-stock lentiviral preps . CRISPR Genomic Screens Genome-wide screens are an efficient way to determine what... use the packaging genes gag , pol , and env to create viral particles. Wild-type lentiviruses additionally...replication-competent lentivirus production — that is, creation of viral particles that could infect cells and...Figure 2: First-generation lentiviral plasmids. Created with BioRender.com. Second-generation Second-generation...Figure 3: Second-generation lentiviral plasmids. Created with BioRender.com. Third-generation The third-...

  18. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...under strong neuron-specific promoters or neural Cre-dependent expression, to visualize connections between... hybrid capsids, and capsids created through directed evolution. Created with BioRender.com. Common Uses...for packaging. Figure 1: Wild-type AAV genome. Created with BioRender.com. AAVs are part of the Dependoparvovirus...-type AAVs have been modified by researchers to create recombinant adeno-associated viral (rAAV) vectors... Plasmids required for rAAV vector production. Created with BioRender.com. AAV Vector Production Cloning... Figure 3: Overview of rAAV vector production. Created with BioRender.com. Genome Integration Recombinant...it is likely that this number will continue to increase. This diversity makes rAAV vectors a very useful...

  19. CRISPR Guide

    Type
    Guide
    ...used for large scale edits. These proteins, like Cre recombinase or phage derived serine integrases, insert...GAT; increased nuclease fidelity SpCas9-NG — NG; increased in vitro activity SpG — NGN; increased nuclease...others work to increase Cas9’s proofreading capabilities. No matter the method, increased fidelity enzymes...backbone HypaCas9 — increase Cas9 proofreading and discrimination evoCas9 — decrease off-target effects...domains to expand PAM recognition, increase specificity, and decrease off-target effects Sniper-Cas9 — ...compatible with truncated gRNAs to increase specificity SuperFi-Cas9 — increases fidelity with reduced nuclease...integration of donor DNA. Genome-Wide Screens Using CRISPR In a genetic screen, a population of cells with mutations...

  20. Guide to Using Pooled Libraries

    Type
    Guide
    ...Negative Screen Negative screens are a little trickier than positive screens. In a negative screen, the goal...plasmid. Library screens can be divided into two types: positive screens and negative screens (Figure 2). ...Types of Screens Resources Pooled libraries represent a powerful tool for forward genetic screening, or identifying...for lentiviral of DNA-based screens. NGS = next-generation sequencing. Created with BioRender.com. Types...Types of Pooled Library Screens In pooled library screens, cells are infected at a very low multiplicity ... of the researcher. Created with BioRender.com. Both positive and negative screens follow the same basic...virus; this creates a pooled lentiviral CRISPR library. Apply pooled library to cells. The screens diverge...
Showing: 941 - 960 of 969 results