...norepinephrine indicators: nLightG and nLightR (Kagiampaki et al., 2023).     Figure 1: Properties...Article 6. https://doi.org/10.1038/s41592-022-01488-1 More resources on the Addgene blog Fluorescent proteins...after application of NE (10 μM) and corresponding pixel-wise ΔF/F0 heatmaps. White insets indicate surface...surface expression of the indicators over white dashed lines. Scale bars, 10 μm (HEK293T), 20 μm (neurons...trialed in two-photon in vivo experiments. nLight indicators are more sensitive to and selective for norepinephrine...They can, however, be studied with the nLight indicators. Speed One of the major advantages of this next...… Patriarchi, T. (2023). Sensitive multicolor indicators for monitoring norepinephrine in vivo. Nature...

...immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward... Rabbit beta-globin polyA region, reverse primer CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol ...LexA CGTCAGCAGAGCTTCACCATTG (Caldwell lab) 3' end of LexA DNA binding domain, forward primer LKO.1 5' GACTATCATATGCTTACCGT... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC...tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato, forward primer tdTomato-Rev TCTTTGATGACGGCCATGT 5' end ...primer WPRE-R CATAGCGTAAAAGGAGCAACA 5' end of WPRE, reverse primer XBG-R GACTCCATTCGGGTGTTC Xenopus beta-globin...sequencing primers that Addgene uses for sequence verification of deposited plasmids. Plasmid...

.... Channelrhodopsin-1 (ChR1) is excited by blue light and permits nonspecific cation influx into the cell...based on the LOV2 domain of Avena sativa phototropin 1 LOVETRAP reversibly sequester and release proteins...concept of optogenetics. 2012 Prog Brain Res. 196: 1-28. PMID 22341318 Gradinaru V, Zhang F, Ramakrishnan...diversifying and extending optogenetics. Cell. 196:1-28. PMID 20303157 Han X, Boyden ES. 2007 Multiple-...Limitations and Future Developments. Exp Physiol. 96(1): 19–25. PMID 20621963 Mattis J, Tye KM, Ferenczi ...Channelrhodopsins: cation channels from Chlamydomonas reinhardtii ChR2 Widely used light-gated cation channel from...light of the correct wavelength, the pore opens, cations flow into the cell (yellow dots), and the neuron...

...mediating the entry of SARS-CoV and SARS-CoV-2 viruses. ( 1 ) TMPRSS2 - a serine protease that primes the SARS-CoV... CD147-spike protein . Cathepsin L - Bosch BJ, et al, 2008, J Virol. Cathepsin L Functionally Cleaves ... is involved in virus entry into cells. ( 4 ) Cathepsin L - a cysteine endosomal protease that triggers...Andrew Ellington's lab. High-surety isothermal amplification and detection of SARS-CoV-2, including with ...

...wondering what her cat is thinking. Find her on Twitter @JessicaSacher.   References 1. Nobrega, Franklin...which is also gaining a lot of new traction lately (1, 2), depends on knowledge of the structure(s) a given...RBPs successfully identified using this method. Step 1: Prepare a random fragment library of phage DNA This...first step involves digesting phage genomic DNA into 1-3 kb (approximately gene-sized) fragments so that ...in the bulk of resultant fragments falling between 1 and 3 kb results in optimal likelihood of capturing...solution-soaked filter paper (colony-side up) and leave for 1 h at room temperature. After this, it is helpful to...proteins expressed by your library. After blocking for 1 h at room temperature with gentle shaking, gently ...

...first before larger fragments. Figure 1: The quantification of a RNA ladder using capillary electrophoresis...automated. Unlike gel electrophoresis, you only need 1-2 ul of sample and the run time is just a few minutes...see any signs of DNA in your final tube after purification. How do you know if you actually have DNA in...you choose could be based on your downstream application, time, and instrument availability. UV absorbance... at 230 nm. The A260/A280 ratio is used as an indicator of DNA purity. Ideally, this number should be ...like a PCR product). This method also gives an indicator of DNA or RNA contamination based on the presence... about quantifying DNA In choosing your DNA quantification method there’s many things to consider: cost...

...the journal-specific guidelines.  Peer-review step 1: The first read At the first read of the paper, I ...group of Prof. Mark Tester, where she focuses on (1) salt-induced changes in root-to-shoot ratio in Arabidopsis... to help decide whether work is suitable for publication in their journal. The early peer-review attempts...information that would prevent the study to be replicated or omission from the literature. I think that...Addgene.org Learn about depositing plasmids pre-publication Find molecular biology protocols Find eBooks ...

... Antigen-1 (oriP-EBNA-1) system where each vector contains a viral origin of DNA replication, OriP and...pCXWB-EBNA-1 is used in the reprogramming cocktail. pCXWB-EBNA-1 lacks oriP and is unable to replicate in human...and the EBNA-1 sequence that encodes for the DNA binding protein EBNA-1 [7]. These two sequences are necessary...expressing additional EBNA-1 transiently. The transiently expressed EBNA-1 increases protein expression...pCXLE vectors listed below in Table 1 are available at Addgene. Table 1: List of pCXLE episomal plasmids,...sufficient for retention and replication of the vectors in human cells [8]. The EBNA-1 protein recognizes OriP...obtained and the subsequent reprogramming success [1]. Fibroblasts need to be cultured and expanded in ...

...General Design Figure 1: Two proteins are fused to the FP(11) and FP(1-10) fragments. When Protein...and 11 to yield large (1-10) and small (11) fragments. In several cases an FP(1-10) fragment may be compatible...Description Article PI Blue EBFP2 EBFP2(1-10) and Capri(1-10) for use with GFP(11) Multiplexed labeling...Commun. 2017 Bo Huang mNeonGreen3 mNG3K(1-10) and mNG3A(1-10) for use with mNG2(11) Improved yellow-...sfCherry2 sfCherry2(1-10) and sfCherry2(11), also photo-activatable variant PAsfCherry2(1-10) Improved split...brings the pieces of the FP back together (Figure 1). This method is generally known as Bimolecular Fluorescence...even from a different base FP (for example, EBFP2(1-10) can be used with GFP(11)). Some of the articles...

...and placed in a buffer. Antibody Structure Figure 1: Structure of an antibody A standard antibody is made... together to form a “Y” shape, as shown in Figure 1. The two arms of the Y structure are responsible for...Handling Visualization Signal Amplification Application Overview Quantification Methods Capture Methods Visualization...Antibody Applications Antibody-based applications can be generally classed into four categories: Quantification... Read on to learn more about the applications common to each category, including an outline of the basic...these applications, visit the Antibody section of the Addgene Protocols page. Antibody Applications - Quantification...concentrates in the sample. Controls for quantification methods Quantification methods should be run with: a positive...

...several advantages over traditional vaccines, including 1) cellular responses in addition to antibody response...and immunogenicity of attenuated, nef-deleted HIV-1 strains in vivo. Retrovirology. 2007 Sep 23;4:66. ...their use in other clinical applications. In the last decade, viral applications in cancer treatment and ...s unpack the myriad number of emerging viral applications and give you some recommendations for putting...putting viruses to work. Viral applications Viruses work by infecting a host cell (the target of viral infection...expressed. It’s important to note that for all the applications we discuss, there is more than one type of virus...retrovirus, AAV, etc.). When you’ve decided on an application, our Viruses as Biological Tools blog can help...

...NLS-mRuby2 Control Gradinaru 83900 pAAV-mDlx-GFP-Fishell-1 Dlx GFP Control Fishell 83895 pAAV-hDlx-Flex-GFP-Fishell...the functional catagories listed below. Narrow down the items available within a category by using the ...experiments can be found on the material pages for viral catalog items. Browse Available Retrograde AAV See our ... Tools Clear Filters ID Name Promoter Activity Category PI 37825 AAV-CAG-GFP CAG GFP Control Boyden 51502...offers you even more options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral...

...Addgene, we use seven different types of “plates” (Fig. 1). When you have to tell an engineer that you want ...”? We took steps towards solving this problem by 1) making sure we qualified these words when we discussed.... I needed to a) figure out the sources of miscommunication and b) find practical solutions.  My PhD ... for this task. Good scientists learn how to communicate their work differently based on their audience... family is going to vary widely. The way you communicate your science at a poster is going to vary depending...two main problems with Addgene’s cross team communication. Although these real world examples did not ... for the container to be used in cross-team communication A list of “AKA” names, or jargon terms, for ...

...    Figure 1: A 1 mg/mL control is diluted in a series ranging from 1:2 to 1:32. Each individual...trendline. R2 ranges from 0 to 1 with 1 being a perfect fit and 0 indicating that there is no linear relationship...example, Figure 1 depicts a 2-fold dilution series. Each step of the series dilutes by 1:2 for a series...series that ranges from 1:2–1:32. The specific dilution series used will depend on the expected concentration...individual step of the series is consistent at 1:2. When preparing a dilution series, use a new pipette tip for... be run in duplicate or triplicate. The closeness of the data points generated by replicate values provides... the standard dilution series in duplicate or triplicate. Replicates allows you to calculate the curve...

...sequences containing a G nucleotide at position 20 (1 bp upstream of the PAM) may be more efficacious than...population. Some cells may be wild type due to either (1) a lack of gRNA and/or Cas9 expression or (2) a lack... in vitro and in vivo. Nature Biotechnology . 33 (1), 73–80. PMID: 25357182...Manipulation Select Expression System Design gRNA Publications Get Started CRISPR is a powerful system that...may not be a perfect plasmid for your specific application, and in such cases, it may be necessary to customize...reagent to suit your needs. Genetic Manipulation Application Cas9 gRNA Additional Considerations Knockout ...method Expression System Components of System Application Mammalian expression vector Cas enzyme promoter...

...Table 1 below outlines a few of the more common genetic changes found in E. coli strains. Table 1: Common...pooled library amplification. F' mcrA Δ(mcrBC-hsdRMS-mrr) recA1 endA1 gyrA96 gal-thi-1 supE44 λ-relA1 ...amber (UAG) stop codon by tyrosine insertion λ-thi-1 or thi1 Mutation in thiamine metabolism Requires exogenous... all based on E. coli K-12 and are considered BSL-1. Table 2: Lab strains of E. coli Strain Natural...plasmids, blue/white screening. F- endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG Φ80dlacZΔM15 Δ(lacZYA-argF...) recA13 leuB6 ara-14 proA2 lacY1 galK2 xyl-5 mtl-1 rpsL20(SmR) glnV44 λ- JM109   General cloning and...strain for cloning repetitive DNA. endA1 glnV44 thi-1 relA1 gyrA96 recA1 mcrB+ Δ(lac-proAB) e14- [F' traD36...

...of 0.3, as recommended by the original publication. Pro-Tip: 1. Use multiple gRNAs to target different..., as indicated by the presence of a 428 bp digestion product (lane 2). The undigested (-, lane 1) DNA ...The entire process from start to finish took about 1 month. Cas9 delivery Overview: Before any editing...lentiviral vector, lentiCas9-Blast (52962-LV, Figure 1). Some cells were then used to generate a monoclonal...rest of the cells were frozen down. Figure 1: Cas9 expression in A549 cells transduced with lentiCas9...Western blotting is a loading control. Pro-Tips: 1. It’s all about the MOI. In retrospect I used a way... pool had wildly variable Cas9 expression (Figure 1). This is a problem because Cas9 expression affects...

...promoters. Gene Therapy, 28(1–2), 56–74. https://doi.org/10.1038/s41434-020-0169-1 Oh, J. Y., Han, J. H., ...AAV Serotypes and Their Applications in Gene Therapy: An Overview. Cells, 12(5), 1–41. https://doi.org/10.3390...constitutive promoters located in adeno-associated viral vectors. PLoS ONE, 9(8), 1–10. https://doi.org/...the selection process. Factors to think about are (1) your experimental conditions and measurements; (2...serotype, promoter, and titer.     Figure 1: Flow chart depicting a) steps for selecting serotypes...injection site than AAV2 (Watakabe et al., 2015) (Figure 1). You’ll need to consider if such properties could...

...chromosome, start, and stop. For instance (chr3, 1, 10) indicates a stretch of DNA at the very beginning of .... Table 1: An emerging family of "GPS for the genome" techniques Technique What It Locates ChIP-seq...clinical applications of CRISPR in the next section. In order to denote the NANOG enhancers from step 1 with...genetic elements like protein, RNA, and DNA (Table 1). As with GPS in the real world, coordinates alone...enhancers with the help of genome math. Figure 1: Genome math illustrated. Intersect (left) and set...histones with “GPS for proteins,” ChIP-seq from Table 1. Because of DNA’s 3D geometry and the chemical properties...experiment to identify the critical NANOG binding sites: 1. Find Enhancers that have NANOG binding sites 2. Design...

...the antibody’s dynamic range. Specifically, the 1:2, 1:1, and No dilution samples all have approximately... doing the purification and cross-adsorption in lab, consider a dilution range from 1:100–1:1,000. If ...recommended dilution and/or range (typically between 1:500 and 1:10,000 for primary antibodies). You’ll want to...from ascites fluid, try a dilution range from 1:1,000–1:100,000. Secondary antibodies For secondary antibodies...recommended dilution range is usually between 1:5,000 and 1:200,000. Check the manufacturer’s recommendations...antibodies that are not.   Table 1: Troubleshooting a western blot *indicates a diagnostic-only step Issue...reagent (usually an antibody).      Figure 1: A protein gradient. The density of the bands, which...