...Figure 1). Clustered events are called a population.                             Figure 1: While..., Eguía, J., Gonzalez-Martinez, G., Alfaro, R., Galián Megías, J. A., Campillo, J., Moya-Quiles, M., Minguela...

...vectors (e.g. pBV-Luc) and gene silencing (e.g. pLKO.1 - TRC cloning vector). Check out our complete guide...integration into the fly genome and are under the Gal4 inducible UAS promoter. Other vectors can be expressed...

...and drawbacks of four split AAV vector approaches. 1. Overlapping  Overview: The overlapping strategy has...Adeno-Associated Virus Capsids. Human Gene Therapy Methods 27:1–12 . https://doi.org/10.1089/hgtb.2015.140 Frischmeyer...Expression from the hybrid vector, as measured by β-galactosidase activity, was 81% of that from a single vector...

... CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter...end of LexA DNA binding domain, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC...origin, forward primer GAL1 AATATACCTCTATACTTTAACGTC (Invitrogen) S. cerevisiae GAL1 promoter, forward primer...primer Gal10pro-F GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae GAL10 promoter, forward primer Gal4...GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding domain, forward primer Gal4-AD AATACCACTACAATGGAT (BD Biosciences...Biosciences) 3' end of Gal4 activation domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP...

...efficiently with adenovirus and AAV.   Table 1: Types of viruses and their features Choosing .... DOI: 10.1016/j.gendis.2017.04.001 Maetzig T, Galla M, Baum C, Schambach A. Gammaretroviral vectors:...

...accessible to practically everyone.     Fig. 1: Open source hardware builds   Since I started...components. In this field, often referred to as 'frugal science', existing components are adapted and combined...

...see how you use them in your research!  References 1.Tang, Jonathan C.Y., et al. “A nanobody-based system... components: GBPa-VP16 (activation domain); GBPb-GAL4 (DNA-binding domain); and a UAS-driven luciferase...

...Communications , 9 (1). PMID: 30082838 Maddalo, D., Manchado, E., Concepcion, C. P., Bonetti, C., Vidigal, J. A., ... most popular genome engineering approach. Figure 1: Overview of the basic CRISPR mechanism Engineered...from Staphylococcus aureus ) has a coding sequence ~1 kb shorter than SpCas9 while retaining the same basic...lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included in the gRNA-containing...efficiency and fidelity. Nature Communications , 13 (1), 1425. PMID: 35301321 Edraki, A., Mir, A., Ibraheim...interrogation by SpRY-Cas9. Nature Communications , 15 (1), 3663. PMID: 38688943 Hsu, P. D., Scott, D. A., Weinstein...CRISPR-Cas9 with Bacteriophage Proteins. Cell , 168 (1–2), 150-158.e10. PMID: 28041849 Sakuma, T., Nishikawa...

...lentiviral transfer plasmids are based on the HIV-1 virus. For safety reasons, transfer plasmids are all...shRNA‐expressing lentiviral plasmids, such as pLKO.1, use a U6 or H1 promoter in order to drive RNA pol...protocol for using the popular cloning vector pLKO.1. Trono Lab Resources: Lentivectors Toolbox and Maps...selection. Desfarges S, Ciuffi A. Viruses. 2010. Jan;2(1):111-30. PubMed . Altering the tropism of lentiviral...Curr Gene Ther. 2005. 5(4): 387-398. PubMed . HIV-1 Genome Nuclear Import Is Mediated by a Central DNA...cells by a lentiviral vector. Naldini L, Blömer U, Gallay P, Ory D, Mulligan R, Gage FH, Verma IM, and Trono...

...impacts of neural circuits on behavior. Figure 1: An overview of the chemogenetics system. Why use...Bonaventura J, Zemla R, Gomez J, Ramirez M, Hu X, Galvan A, Basu J, Michaelides M, Sternson S (2019) Ultrapotent...

...editing machinery such as CRISPR-Cas. Figure 1: Schematic of targeted gene knock-out (left) and targeted...Maddalo D, Manchado E, Concepcion CP, Bonetti C, Vidigal JA, Han Y-C, Ogrodowski P, Crippa A, Rekhtman N...

...algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited by blue light and permits nonspecific...based on the LOV2 domain of Avena sativa phototropin 1 LOVETRAP reversibly sequester and release proteins...concept of optogenetics. 2012 Prog Brain Res. 196: 1-28. PMID 22341318 Gradinaru V, Zhang F, Ramakrishnan...diversifying and extending optogenetics. Cell. 196:1-28. PMID 20303157 Han X, Boyden ES. 2007 Multiple-...Limitations and Future Developments. Exp Physiol. 96(1): 19–25. PMID 20621963 Mattis J, Tye KM, Ferenczi ...both the identification of novel ChRs from other algal species and the development of synthetic variants...

...fun together! Laura’s Top 10 Event Planning Tips! 1. Take suggestions Some of Addgene’s best events have...tournament or beer hour (only if it’s cool with your legal department) right in your breakroom. 5. Throw some...

... such a popular model organism? Zebrafish (Figure 1) were initially recognized as a useful vertebrate ... bacteriophage integrase phiC31. The popular UAS/Gal4 and Cre/Lox gene regulatory systems have also been...

...indel formation and phenotypic changes as early as 1 week post-injection. Livers from these mice were histologically...Brötzmann J, Staahl BT, Taylor KL, Desmarais J, Nogales E, Doudna JA (2019) CasX enzymes comprise a distinct...

...complex. So how exactly does this work? Figure 1: APOBEC- and Cas9-mediated editing (ACE) reporter ...D, Serebrenik A, Shaban N, Brown WL, Donati F, Munagala U, Conticello SG, Harris RS (2018) A fluorescent...

...yourself in a creative rut, read on!   Fig 1: Blugene using creative problem-solving in the lab... weird face your fears and unleash creativity. Gallery Books. Boyes, A. (2019, November 13). 5 mental ...

...SpCas9 base editors with editing windows as small as 1-2 nucleotides! To reduce off-target effects associated...Lower on-target activity than BE3; editing window ~1-2 nt  87438  pET42b-HF-BE3  HF-Cas9 (NGG)  Very ...technique to beautifully demonstrate light-dependent Gal4 transcriptional activation and Cre recombination...

...mycoplasma can even escape 0.2-micron filters. Figure 1: Contamination! Tissue culture media often have indicators... mycoplasmas but also avoid other bacterial and fungal contamination. Proper PPE Since humans are the ...

...out our Chemogenetics Plasmid Collection . Figure 1: General overview of a chemogenetics experiment. Early...bidirectional control of neuronal activity. Table 1. Descriptions of DREADDs and their activity in neurons... while PSAMs and LMOs have an effect for only 0.5–1 hours after delivery. Chemogenetic ligand. The chemogenetic...Bonaventura J, Zemla R, Gomez JL, Ramirez MH, Hu X, Galvan A, Basu J, Michaelides M, Sternson SM (2019). Ultrapotent...