We narrowed to 102 results for: gal.1

...and drawbacks of four split AAV vector approaches. 1. Overlapping  Overview: The overlapping strategy has...Adeno-Associated Virus Capsids. Human Gene Therapy Methods 27:1–12 . https://doi.org/10.1089/hgtb.2015.140 Frischmeyer...Expression from the hybrid vector, as measured by β-galactosidase activity, was 81% of that from a single vector...

...efficiently with adenovirus and AAV.   Table 1: Types of viruses and their features Choosing .... DOI: 10.1016/j.gendis.2017.04.001 Maetzig T, Galla M, Baum C, Schambach A. Gammaretroviral vectors:...

...accessible to practically everyone.     Fig. 1: Open source hardware builds   Since I started...components. In this field, often referred to as 'frugal science', existing components are adapted and combined...

...see how you use them in your research!  References 1.Tang, Jonathan C.Y., et al. “A nanobody-based system... components: GBPa-VP16 (activation domain); GBPb-GAL4 (DNA-binding domain); and a UAS-driven luciferase...

...impacts of neural circuits on behavior. Figure 1: An overview of the chemogenetics system. Why use...Bonaventura J, Zemla R, Gomez J, Ramirez M, Hu X, Galvan A, Basu J, Michaelides M, Sternson S (2019) Ultrapotent...

...editing machinery such as CRISPR-Cas. Figure 1: Schematic of targeted gene knock-out (left) and targeted...Maddalo D, Manchado E, Concepcion CP, Bonetti C, Vidigal JA, Han Y-C, Ogrodowski P, Crippa A, Rekhtman N...

...fun together! Laura’s Top 10 Event Planning Tips! 1. Take suggestions Some of Addgene’s best events have...tournament or beer hour (only if it’s cool with your legal department) right in your breakroom. 5. Throw some...

... such a popular model organism? Zebrafish (Figure 1) were initially recognized as a useful vertebrate ... bacteriophage integrase phiC31. The popular UAS/Gal4 and Cre/Lox gene regulatory systems have also been...

...indel formation and phenotypic changes as early as 1 week post-injection. Livers from these mice were histologically...Brötzmann J, Staahl BT, Taylor KL, Desmarais J, Nogales E, Doudna JA (2019) CasX enzymes comprise a distinct...

...complex. So how exactly does this work? Figure 1: APOBEC- and Cas9-mediated editing (ACE) reporter ...D, Serebrenik A, Shaban N, Brown WL, Donati F, Munagala U, Conticello SG, Harris RS (2018) A fluorescent...

...yourself in a creative rut, read on!   Fig 1: Blugene using creative problem-solving in the lab... weird face your fears and unleash creativity. Gallery Books. Boyes, A. (2019, November 13). 5 mental ...

...SpCas9 base editors with editing windows as small as 1-2 nucleotides! To reduce off-target effects associated...Lower on-target activity than BE3; editing window ~1-2 nt  87438  pET42b-HF-BE3  HF-Cas9 (NGG)  Very ...technique to beautifully demonstrate light-dependent Gal4 transcriptional activation and Cre recombination...

...mycoplasma can even escape 0.2-micron filters. Figure 1: Contamination! Tissue culture media often have indicators... mycoplasmas but also avoid other bacterial and fungal contamination. Proper PPE Since humans are the ...

...England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA Δ(mrr-hsdRMS-mcrBC...mB-) recA13 supE44 ara-14 galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ- leu mtl-1 Top10 Invitrogen F- mcrA ... DNA fragments of interest, such as genes. Figure 1: Creation of recombinant DNA. Working with Plasmids...U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 tonA EPI300 LGC Biosearch Technologies... Promega e14-(McrA-) recA1 endA1 gyrA96 thi-1 hsdR17(rK- mK+) supE44 relA1 Δ(lac- proAB) [F traΔ36 proAB...Phi80lacZΔM15 Δ-lacX74 recA1 araΔ139 D(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG tonA::Ptrc ccdA DB3.1 Invitrogen...Φ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL (StrR) nupG trfA dhfr JM109 Addgene; Promega...

...gene, and a terminator, as in Figure 1). Next, up to six Level 1 modules can be assembled into a Level...consists of three sets of cloning vectors (Level 0, 1, and 2) which can be used in successive assembly steps... 0 parts are directionally assembled into a Level 1 vector creating a single transcriptional unit (for...maintain the final plasmid after transformation. Figure 1: Overview of the MoClo Toolkit components and assembly... CRISPR editing, and more. Fungal Toolkit for Modular Cloning (FTK) Fungal Expression, CRISPR Arnold Driessen...Cultivarium POSSUM Toolkit Bacterial Expression, Fungal Expression Nili Ostrov , Charlie Gilbert , and ...selection markers for a variety of bacterial and fungal species for engineering non-model microbes. AspFlex...

...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward...CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse...origin Reverse GAL1 AATATACCTCTATACTTTAACGTC S. cerevisiae GAL1 promoter Forward Gal10pro-F GGTGGTAATGCCATGTAATATG...GGTGGTAATGCCATGTAATATG S. cerevisiae GAL10 promoter Forward Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding domain...domain Forward Gal4-AD AATACCACTACAATGGAT 3' end of Gal4 activation domain Forward GFP-F GGTCCTTCTTGAGTTTGTAAC...

...human cytomegalovirus EF1a Constituitve Mammalian Strong promoter from human elongation factor 1 alpha... or coding strand of the transcribed gene (Figure 1). The coding strand is the DNA strand that encodes...that is transcribed by the RNA polymerase. Figure 1: Simplified promoter region during transcription. ... actin 5c gene Gal4/UAS Specific Insect Requires UAS regulatory element and yeast Gal4 gene; often used...

...Addgene's Chemogenetics Plasmid Collection . Figure 1: General overview of a chemogenetics experiment. Early...bidirectional control of neuronal activity. Table 1: Descriptions of DREADDs and their activity in neurons... while PSAMs and LMOs have an effect for only 0.5–1 hours after delivery. Chemogenetic Ligand The chemogenetic...Causal Cellular and Neuronal Biology. Physiol Rev, 98 (1), 391–418. https://doi.org/10.1152/physrev.00009.2017...Neurophotonics 11 (2), 021005. https://doi.org/10.1117/1.NPh.11.2.021005 PMID: 38450294 Coward, P., Wada, H... Gi-coupled receptor. Proc Natl Acad Sci USA, 95 (1), 352–357. https://doi.org/10.1073/pnas.95.1.352 PMID... 451–460. https://doi.org/10.1007/s00213-004-2017-1 PMID: 15765260 Farrell, M. S., Pei, Y., Wan, Y., Yadav...

...Communications , 9 (1). PMID: 30082838 Maddalo, D., Manchado, E., Concepcion, C. P., Bonetti, C., Vidigal, J. A., ...changing the target sequence present in the gRNA. Figure 1: Overview of the basic CRISPR mechanism. CRISPR was...from Staphylococcus aureus ) has a coding sequence ~1 kb shorter than SpCas9 while retaining the same basic...lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included in the gRNA-containing...efficiency and fidelity. Nature Communications , 13 (1), 1425. PMID: 35301321 Edraki, A., Mir, A., Ibraheim...interrogation by SpRY-Cas9. Nature Communications , 15 (1), 3663. PMID: 38688943 Hsu, P. D., Scott, D. A., Weinstein...CRISPR-Cas9 with Bacteriophage Proteins. Cell , 168 (1–2), 150-158.e10. PMID: 28041849 Sakuma, T., Nishikawa...

...typically ranges from 8–10 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...been removed or mutated for increased safety. Figure 1: Wild-type lentivirus genome. Created with BioRender.com...genes (for example, vif , vpr , vpu , and nef for HIV-1). The LTRs flank all of these genes, and anything ...transgene and LTRs (chimeric 5’ LTR) Packaging plasmid 1 — contains gag and pol Packaging plasmid 2 — contains...and third-generation systems, please refer to Table 1. Figure 4: Third-generation lentiviral plasmids. Created...heterologous enhancer/promoter such as CMV or RSV Table 1. Summary of key differences between second- and third-generation...More Lentiviral Vector topics Addgene Protocols pLKO.1 - TRC Cloning Vector Protocols Lentiviral Vector Production...