Skip to main content

We narrowed to 1,082 results for: IND

Showing: 1061 - 1080 of 1082 results
  1. General Transfection

    Type
    Protocol
    ...transfection. Test a variety of brands and lots of FBS to find one suitable with your protocols. FBS can be purchased...
  2. Using a Light Microscope Protocol

    Type
    Protocol
    ...practice to start with the lowest power objective to find your sample. Place your slide (or other sample type...
  3. AAV ddPCR Titration

    Type
    Protocol
    ...publication Lock et al. (2014) (Link opens in a new window) . Before Starting To reduce the risk of contaminating...
  4. Antibody Guide

    Type
    Guide
    ...structure are responsible for binding the antigen, and are called the antigen binding fragments (Fab). The tips...recognizing and binding to epitopes on antigens, they are also capable of recognizing and binding epitopes on...single individual, giving a high probability that an antibody will be able to recognize and bind to any... and binds to the protein of interest. Signal strength is determined by how many antibodies bind the protein...detection antibody is added and binds to the bound protein. If using the indirect sandwich method, a conjugated...? Will you be using a direct or indirect detection method? If indirect, do you already have secondary ...tools used in the lab to specifically and tightly bind to other proteins. Antibodies, produced as part ...
  5. CRISPR Guide

    Type
    Guide
    .... gRNA binding induces a conformational change in Cas9, shifting it into an active, DNA-binding configuration...( C lustered R egularly I nterspaced S hort P alindromic R epeat) technologies. Before CRISPR, genome ...composed of a scaffold sequence necessary for Cas-binding and a user-defined ∼20-nucleotide spacer that defines... otif (PAM) The PAM sequence (NGG) serves as a binding signal for Cas9, but the exact sequence depends...with the target DNA. Once the Cas9-gRNA complex binds a putative DNA target, the seed sequence (8–10 bases...undergoes a second conformational change upon target binding. In this formation, its nuclease domains, RuvC ...causes small nucleotide insertions or deletions (indels) at the DSB site. Therefore, a population of cells...
  6. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ... proteins Rep78 and Rep68, which can bind to specific Rep-binding elements present in the AAV ITRs and....024 (Link opens in a new window) PMID: 15294177 (Link opens in a new window) Chan, K. Y., Jang, M. J.....4593 (Link opens in a new window) PMID: 28671695 (Link opens in a new window) Deyle, D. R., & Russell,....2001.0456 (Link opens in a new window) PMID: 11592843 (Link opens in a new window) Grimm, D., & Kay, M. A. ...1566523034578285 (Link opens in a new window) PMID: 12871018 (Link opens in a new window) Hüser, D., Weger, S., & ...4887.2003 (Link opens in a new window) PMID: 12663794 (Link opens in a new window) Kwon, I., & Schaffer, D....9431-0 (Link opens in a new window) PMID: 17763830 (Link opens in a new window) Liu, D., Li, T., Liu, L....
  7. Promoters

    Type
    Guide
    ...proteins bind to negative-repressible operons and prevent transcription. When an inducer molecule binds to ...region. The TATA-binding protein binds the TATA box and helps in the subsequent binding of the RNA polymerase...repressor (lacI or lacIq). Can be induced by IPTG or lactose araBAD Inducible by arabinose Promoter of the ...the RNA polymerase binding site, TATA box, and TSS. RNA polymerase will stably bind to this core promoter...package DNA into nucleosomes) also bind the TATA box. Histone binding prevents the initiation of transcription...(Tet) Inducible Expression Plasmids 101: The Promoter Region — Let's Go! Plasmids 101: Inducible Promoters...of expression vectors because they control the binding of the RNA polymerase to DNA. RNA polymerase transcribes...
  8. Adenovirus Guide

    Type
    Guide
    ...156652311796150372 (Link opens in a new window) PMID: 21453277 (Link opens in a new window) Bulcha, J. T., Wang, Y.,...00487-6 (Link opens in a new window) PMID: 33558455 (Link opens in a new window) Bullard, B. L., Corder, ...60238-5 (Link opens in a new window) PMID: 32107394 (Link opens in a new window) Ewer, K. J., Sebastian, ...21645515.2017.1383575 (Link opens in a new window) PMID: 29083948 (Link opens in a new window) Geisbert, T. W., Bailey,....02407-10 (Link opens in a new window) PMID: 21325402 (Link opens in a new window) Gilbert, S. C. (2015). Adenovirus-vectored...14760584.2015.1077122 (Link opens in a new window) PMID: 26289977 (Link opens in a new window) He, T. C., Zhou, S., da ....95.5.2509 (Link opens in a new window) PMID: 9482916 (Link opens in a new window) Lee, C. S., Bishop, E. S....
  9. Optogenetics Guide

    Type
    Guide
    ...system, light induces a conformational change in cryptochrome Cry2 to permit CIB1 binding. As shown in ...in the figure above, this light induced binding can be utilized to control the localization of a protein...natural binding partner SspB is included in a separate plasmid; Blue light activation induces a conformational...light. light-induced protein dissociation using protein A fragments (called Zdk) that bind to the LOV domain...opens in a new window) , Edward Boyden Lab Optogenetics Resources (Link opens in a new window) , Karl Deisseroth...more information on biosensors such as calcium indicators or voltage sensors, visit our Biosensors Plasmid...engineering to improve these natural opsins by inducing point mutations to alter the absorption spectrum...
  10. Molecular Biology Reference

    Type
    Guide
    ... chromosomes, which are composed of DNA. These findings culminated in the central dogma of molecular biology...carry genetic information and can replicate independently from chromosomal DNA. Although they can be found...cells by visualization or flow cytometry. Primer Binding Site A short, single-stranded DNA sequence used...extrachromosomally in E. coli , it is replicated independently and segregated to the resulting daughter cells... of E. coli used today are descended from two individual isolates, the K-12 strain and the B strain. K...Each bacterium can contain multiple copies of an individual plasmid, and ideally would replicate these plasmids... on antibiotic resistance genes . Below you will find a few antibiotics commonly used in the lab and their...
  11. Plan Your Experiment

    Type
    Guide
    ...( C lustered R egularly I nterspaced S hort P alindromic R epeats) is a powerful system that enables researchers... you first need to have a biological question in mind. Then you can decide how to answer that question... Cas9 exert their activity within a very narrow window proximal to the PAM sequence Base Edit Prime Edit...reverse transcriptase (RT)) Can edit within a wider window than most base editors Editing efficiency can be... choose from. Below are a few factors to keep in mind when designing and cloning your gRNAs. Select Genetic... editors exert their functions within a limited window from the PAM sequence, and base editor variants...variants often have different optimal editing windows. Be sure to refer to the literature associated with your...
  12. Chemogenetics Guide

    Type
    Guide
    ...seven-pass transmembrane proteins that bind a specific ligand. Ligand binding then activates G-proteins to modulate...β-arrestin to activate noncanonical GPCR signaling independent of G proteins. This DREADD, termed Rq(R165L),...Unlike DREADDs, which manipulate neuronal activity indirectly through GPCR signaling, another class of chemogenetic...Glycine-receptor (GlyR) chloride-selective IPD. Binding of the cognate PSEM allows for the influx of Cl...serotonin receptor sodium- or potassium-selective IPD. Binding of the cognate PSEM allows for influx of Na + and...is direct, while neuronal control of DREADDs is indirect. DREADD ligands affect signaling for up to 8 hours...opsins for versatile, scalable, and hardware-independent optogenetic inhibition. Sci Rep, 5 , 14366. https...
  13. Lentiviral Vector Guide

    Type
    Guide
    ...the lentivirus HIV and the gamma-retrovirus MMLV indicate that the viral integrase plays a role in shaping...stable cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there are...viral vectors. R in cis Repeat region where Tat binds. TAR in cis Trans-activating response element; found... found in the R region and acts as the binding site for Tat. U5 in cis Unique 5'; in third-generation ... Element; the sequence to which the Rev protein binds. Psi (Ѱ) in cis RNA packaging signal; recognized...transcriptase and integrase components. rev in trans Binds to the Rev Response Element (RRE) within unspliced...packaging plasmids. tat in trans Trans-activator; binds TAR to activate transcription from the LTR promoter...
  14. Molecular Cloning Techniques

    Type
    Guide
    ...Created with BioRender.com. Ligation Independent Cloning Ligation Independent Cloning (LIC) relies on the 3'...Gateway TOPO Gibson Golden Gate & MoClo Ligation Independent Cloning Yeast-Mediated & Oligo Stitching Resources...project. Restriction enzyme cloning also leaves behind a short scar in the DNA sequence and can be time-consuming...by PCR DNA ligation Gibson assembly Ligation independent cloning Addgene Blogs Plasmids 101: Restriction... Cloning Plasmids 101: Sequence and Ligation Independent Cloning (SLIC) More Plasmids 101 topics More ...
  15. Modular Cloning Guide

    Type
    Guide
    ...Learn about modular cloning (MoClo) and find MoClo kits deposited with Addgene, including the MoClo Toolkit...terminators, etc.) flanked by fusion sites into individual Level 0 plasmids, or choose from a growing number...from Addgene Browse or search the table below to find MoClo kits in our collection. Kit name Type PI Description...Shapiro 96 cross-compatible plasmids including 11 inducible promoters, 16 RBS strength variants, 8 tag-compatible...complexes in various hosts. Expression cassettes for individual subunits are first assembled by Golden Gate cloning...Huimin Zhao Plasmids to assemble custom-made RNA-binding proteins based on the Pumilio and FBF (PUF) homology...
  16. Science Guides

    Type
    Guide
    ...scientific concepts related to our plasmid collection. Find links to the guides below. Antibodies Chemogenetics...antibodies are proteins capable of highly specific binding to other proteins. Antibody-based applications,...2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR) systems, which form an adaptive...bacteria, have been modified for genome engineering. Find essential background information on CRISPR and the...restricted to certain gene sets. Read More Viral Vectors Find educational guides to learn more about the different...
  17. Sequencing Primers

    Type
    Guide
    ...Find a list of universal sequencing primers and other common sequencing primers.... that may be useful in your sequencing reaction, find your plasmid’s page and see what primers are listed... N-term GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding domain Forward Gal4-AD AATACCACTACAATGGAT 3' end...LexA CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT...MBP-F GATGAAGCCCTGAAAGACGCGCAG 3' end of maltose binding protein Forward mCherry-F CCCCGTAATGCAGAAGAAGA ...
  18. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...stable cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there are...sorted cells are expanded into a cell line. You can find more information in Addgene’s stable cell line protocol...Day, W., Stevenson, E., Madigan, M., Chen, J., Khinder, R., . . . Pule, M. (2022). Efficient clinical-...Immunogenicity The ability of a molecule or substance to induce an immune response in the body. in cis In the context...
  19. Educational Resources

    Type
    Guide
    ...Information Molecular Cloning Techniques Protocols Find written and video protocols for a wide range of ...
Showing: 1061 - 1080 of 1082 results