We narrowed to 129 results for: primer

...sequence, and an extension sequence containing a primer binding site and a reverse transcription template...length of the RTT overhang, the GC content of the primer binding site, and many more. Once we had our datasets...

...suitable for PCR amplification using pre-designed primers. By using this library to infect an animal expressing...from the infected animal and use the pre-designed primers to determine which version(s) of the capsid gene...

...method of choice. Step 5: Colony Screening Use Primer 92F (5′-cattacgcaattggacgacaac-3′) and Oligo 2 ...sequencing using either 92F or M13R as the sequencing primer. Step 7: Transformation Your confirmed plasmid...

...for proteins required for strand invasion and a primer for DNA repair synthesis. The ssDNA strand then...invade an intact homologous template to serve as a primer for DNA repair synthesis, ultimately leading to...

...activity, enhance binding between the template and primer binding site, increase processivity, or improve...editor; RTT = reverse transcriptase template; PBS = primer binding site. Image from Doman et al., 2023, under...containing the reverse transcriptase template and primer binding site. If this tail is degraded, the truncated...

..., but couldn't amplify the EMX1 gene using same primer you used in the Science paper (Cong et al., 2013...publication of our paper, we have two new optimized primers that may work better than the published ones, so...reaction still does NOT work, you can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse...

...unresolved and small, so I suggest designing your primer at least 50bp upstream of the sequence of interest...

...design (10 different prediction scores), clone (primer design), and evaluate gRNAs, as well as predict...

...folding. One also needs to avoid primer-primer annealing which creates primer dimers and disrupts the amplification... Protocols Designing Primers How to Design a Primer You may also like...Agarose Gel Electrophoresis Primer Design for PCR Oligonucleotide primers are necessary when running a...ends of the hybridized primers must point toward one another. The size of the primer is very important as...hand, a long primer is used to amplify a eukaryotic genomic DNA sample. However, a primer should not be... be too long (> 30-mer primers) or too short. Short primers produce inaccurate, nonspecific DNA amplification...temperature (Tm) of 50-60°C Primer pairs should have a Tm within 5°C of each other Primer pairs should not have...

...protein databases, DNA sequence manipulation, and primer design. Best wishes for the new year and your ...