Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 130 results for: primer

Showing: 51 - 60 of 130 results

  1. Anatomy of a Plasmid Page at Addgene

    Type
    Blog Post
    ... in their own lab.  If depositors have provided primer sequences for use, these are listed.  We also provide... provide a link to our list of common primers used for sequencing. Growth in Bacteria: This section describes...

  2. PRIDICT: Predicting Efficiencies of Prime Editing Guide RNAs

    Type
    Blog Post
    ...sequence, and an extension sequence containing a primer binding site and a reverse transcription template...length of the RTT overhang, the GC content of the primer binding site, and many more. Once we had our datasets...

  3. AAVs CREATed for Gene Delivery to the CNS and PNS

    Type
    Blog Post
    ...suitable for PCR amplification using pre-designed primers. By using this library to infect an animal expressing...from the infected animal and use the pre-designed primers to determine which version(s) of the capsid gene...

  4. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...by homology to a genomic DNA locus and encodes a primer binding site and the desired edits on an RT template...

  5. CRISPR 101: Homology Directed Repair

    Type
    Blog Post
    ...for proteins required for strand invasion and a primer for DNA repair synthesis. The ssDNA strand then...invade an intact homologous template to serve as a primer for DNA repair synthesis, ultimately leading to...

  7. Prime Editing: Adding Precision and Flexibility to CRISPR Editing

    Type
    Blog Post
    ...activity, enhance binding between the template and primer binding site, increase processivity, or improve...editor; RTT = reverse transcriptase template; PBS = primer binding site. Image from Doman et al., 2023, under...containing the reverse transcriptase template and primer binding site. If this tail is degraded, the truncated...

  8. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ..., but couldn't amplify the EMX1 gene using same primer you used in the Science paper (Cong et al., 2013...publication of our paper, we have two new optimized primers that may work better than the published ones, so...reaction still does NOT work, you can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse...

  10. CRISPR Plasmids - Plants

    Type
    Collection
    ...by homology to a genomic DNA locus and encodes a primer binding site and the desired edits on an RT template...
Showing: 51 - 60 of 130 results