... Ko 139670 pTFUbiCre Cre Maize Ubiquitin Plant Birchler 140131 pAAV-EF1a-NCreV N-terminal Cre component...

...add hydrochloric acid until the solution clears. Check the pH of the solution and use hydrochloric acid... pH 8.5 + 60 mL of 5 M Sodium Chloride + 4 mL of 1 M Magnesium Chloride Close the bottle and mix by inverting...

...dibasic, Millipore Sigma S7907-500G 1 M Trizma hydrochloride solution pH 9.0, Millipore Sigma T2819-1L 250...binding buffer 2x . Add 50 µL of 1 M Trizma hydrochloride pH 9.0 to 10 microcentrifuge tubes. Cap the ... into the tubes containing 50 µL 1 M Trizma hydrochloride pH 9.0. Cap the tubes and vortex for 5 s to ...

...salt, Sigma Aldrich P4543-10G Polyethylenimine hydrochloride, M.W. 40000 (PEI-MAX), Linear, Transfection ...7.0 with 10 N sodium hydroxide (NaOH) or 5 N hydrochloric acid (HCl). Note: Adjust the pH slowly, adding...

...extract 10.0 g peptone from casein 10.0 g sodium chloride 12.0 g agar-agar 1 L Sterile H 2 O Sterile plates...5 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol 25 mg/mL (dissolve in EtOH) 25 µg/mL Coumermycin...

... mutations 540 Channelrhodopsins: chloride channels iChloC Chloride-conducting channel, CrChR2 with mutations...species include: CsChR (from Chloromonas subdivisa ), CoChR (from Chloromonas oogama ), and SdChR (from ...channels from Chlamydomonas reinhardtii ChR2 Widely used light-gated cation channel from Chlamydomonas reinhardtii...Channelrhodopsin from Chloromonas oogama CsChR Channelrhodopsin from Chloromonas subdivisa CheRiff Channelrhodopsin...channelrhodopsins were discovered in the green algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited...identified in other species - by acting as light-gated chloride channels, these variants result in the hyperpolarization...include: Increased photocurrent amplitude Examples: iChloC, SwiChRca, Phobos, Aurora Browse Channelrhodospin...

...mL Bleocin 5 µg/mL Carbenicillin 100 µg/mL Chloramphenicol 25 µg/mL Coumermycin 25 µg/mL Gentamycin 10...

... the Video! DNA Purification Miniprep, phenol-chloroform extract, and precipitate DNA DNA Quantification...

... alternative DREADD ligands. Compound 21, Deschloroclozapine (DCZ), Perlapine, and Olanzapine have all...pair a PSAM domain with a Glycine-receptor (GlyR) chloride-selective IPD. Binding of the cognate PSEM allows...Higuchi M, Jin J, Roth BL, Minamimoto T (2020). Deschloroclozapine, a potent and selective chemogenetic actuator...

...alternatives Abudayyeh, O. O., Gootenberg, J. S., Essletzbichler, P., Han, S., Joung, J., Belanto, J. J., Verdine...Gootenberg, J. S., Abudayyeh, O. O., Lee, J. W., Essletzbichler, P., Dy, A. J., Joung, J., Verdine, V., Donghia..., O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S. E., Joung, J., Van Der Oost, ...

...contains: 10g tryptone 5g yeast extract 10g sodium chloride 15g agar Prepare LB agar solution by dissolving...

...primer CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer CMV Forward...

...100 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol 25 mg/mL (dissolve in EtOH) 25 µg/mL Hygromycin...