Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 114 results for: CHL

Showing: 101 - 114 of 114 results

  1. AAV Production in HEK293 Cells

    Type
    Protocol
    ...add hydrochloric acid until the solution clears. Check the pH of the solution and use hydrochloric acid... pH 8.5 + 60 mL of 5 M Sodium Chloride + 4 mL of 1 M Magnesium Chloride Close the bottle and mix by inverting...

  2. Affinity Purification of Recombinant Antibodies with Protein A or Protein G

    Type
    Protocol
    ...dibasic, Millipore Sigma S7907-500G 1 M Trizma hydrochloride solution pH 9.0, Millipore Sigma T2819-1L 250...binding buffer 2x . Add 50 µL of 1 M Trizma hydrochloride pH 9.0 to 10 microcentrifuge tubes. Cap the ... into the tubes containing 50 µL 1 M Trizma hydrochloride pH 9.0. Cap the tubes and vortex for 5 s to ...

  3. Transfection for Recombinant Antibodies

    Type
    Protocol
    ...salt, Sigma Aldrich P4543-10G Polyethylenimine hydrochloride, M.W. 40000 (PEI-MAX), Linear, Transfection ...7.0 with 10 N sodium hydroxide (NaOH) or 5 N hydrochloric acid (HCl). Note: Adjust the pH slowly, adding...

  4. Pouring LB Agar Plates

    Type
    Protocol
    ...extract 10.0 g peptone from casein 10.0 g sodium chloride 12.0 g agar-agar 1 L Sterile H 2 O Sterile plates...5 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol 25 mg/mL (dissolve in EtOH) 25 µg/mL Coumermycin...

  8. Optogenetics Guide

    Type
    Guide
    ... mutations 540 Channelrhodopsins: chloride channels iChloC Chloride-conducting channel, CrChR2 with mutations...species include: CsChR (from Chloromonas subdivisa ), CoChR (from Chloromonas oogama ), and SdChR (from ...channels from Chlamydomonas reinhardtii ChR2 Widely used light-gated cation channel from Chlamydomonas reinhardtii...Channelrhodopsin from Chloromonas oogama CsChR Channelrhodopsin from Chloromonas subdivisa CheRiff Channelrhodopsin...channelrhodopsins were discovered in the green algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited...identified in other species - by acting as light-gated chloride channels, these variants result in the hyperpolarization...include: Increased photocurrent amplitude Examples: iChloC, SwiChRca, Phobos, Aurora Browse Channelrhodospin...

  9. Modular Cloning Guide

    Type
    Guide
    ...including CRISPR/Cas9 components. MoChlo: Modular Cloning Chloroplast Toolbox Plant Expression Scott Lenaghan...Lenaghan 122 plasmids with chloroplast-specific genetic modules, including destination vectors specific...

  10. Chemogenetics Guide

    Type
    Guide
    ... alternative DREADD ligands. Compound 21, Deschloroclozapine (DCZ), Perlapine, and Olanzapine have all...pair a PSAM domain with a Glycine-receptor (GlyR) chloride-selective IPD. Binding of the cognate PSEM allows...Higuchi M, Jin J, Roth BL, Minamimoto T (2020). Deschloroclozapine, a potent and selective chemogenetic actuator...

  11. CRISPR Guide

    Type
    Guide
    ...alternatives Abudayyeh, O. O., Gootenberg, J. S., Essletzbichler, P., Han, S., Joung, J., Belanto, J. J., Verdine...Gootenberg, J. S., Abudayyeh, O. O., Lee, J. W., Essletzbichler, P., Dy, A. J., Joung, J., Verdine, V., Donghia..., O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S. E., Joung, J., Van Der Oost, ...

  12. Lentiviral Vector Guide

    Type
    Guide
    ..., M., Sutherland, H., Saenz, D., Bickmore, W., Poeschla, E., & Bushman, F. D. (2007). Role of PSIP1/LEDGF...science.272.5259.263 PMID: 8602510 Schambach, A., Zychlinski, D., Ehrnstroem, B., & Baum, C. (2013). Biosafety...

  13. Sequencing Primers

    Type
    Guide
    ...primer CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer CMV Forward...

  14. Molecular Biology Reference

    Type
    Guide
    ...100 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol 25 mg/mL (dissolve in EtOH) 25 µg/mL Hygromycin...
Showing: 101 - 114 of 114 results