We narrowed to 1,033 results for: ELL
-
TypeCollection...maintenance. Worms are particularly well suited for studies in cell biology, development, and aging. Scientists.... elegans hermaphrodite consists of 959 somatic cells, which makes them attractive for imaging and fluorescence...microscopy experiments. The C. elegans genome is well studied and hundreds of reporters have been developed...researchers to express desired constructs in precise cell types and/or developmental timeframes. Here we highlight...detection of genome-editing events. Developed in Craig Mello's lab and described in A Co-CRISPR Strategy for Efficient...
-
CRISPR Plasmids - Mammalian Expression
TypeCollection...sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ), a mechanism...PAM site. When a repair template is present, the cell may repair a DSB using homology-directed repair ... time and are potentially heritable in dividing cells. ID Plasmid Gene/Insert Selectable Marker PI Publication...DNA. Type VI enzymes that function in mammalian cells can be used to attentuate RNA levels. In mammalian...genomic loci using fluorescent microscopy in living cells. Design your gRNA sequence to direct the dCas9-FP...Cas protein and a target-specific gRNA in the same cell at the same time. Single plasmids containing both... -
Lentivirus Plasmids
TypeCollection...Lentivirus can transduce both dividing and non-dividing cells without a significant immune response. These viruses... in the viral particle) is delivered to a target cell upon infection. When lentivirus is used for research...the researcher wants delivered to specific target cells. This genome is encoded by plasmids called "transfer...encoded by the transfer plasmid is toxic to mammalian cells, it can be difficult to efficiently produce viral...of viral transduction. Also see plasmid 46948 . Elledge 44011 pInducer10-mir-RUP-PheS 3rd Lentiviral shRNA...transduction. See article for more similar plasmids. Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression... -
Zinc Finger Consortium: OPEN Reagents
TypeCollection...function in zebrafish, plants, and human cells ( Maeder et al., Mol Cell 2008 , Foley & Yeh et al., PLoS ONE... Townsend et al., Nature 2009 , Zou et al., Cell Stem Cell 2009 ). Resources A detailed protocol for practicing...ZFNs that function in zebrafish, plants, and human cells Kits... -
Antibody Production
TypeCollection...mammalian expression vectors, human embryonic kidney cells are transfected with the plasmid(s) encoding the.... This buffer is not compatible for use in live cells and will interfere with conjugation. For applications...antigen is first transiently expressed in mammalian cells. To learn which specific QC experiments were performed...email [email protected] . Immunocytochemistry (ICC) Cells are fixed and labeled with the antibody and a species-specific...Western Blotting (WB) Proteins are extracted from cells, separated by SDS-PAGE, transferred to a membrane... -
Chemogenetics AAV Preps
TypeCollection...pAAV-hDlx-GiDREADD-dTomato-Fishell-5 hM4D(Gi) - Inhibition NLS-dTomato none 1, 9, rg* Gordon Fishell 83897 pAAV-hDlx-GqDREADD-dTomato-Fishell...pAAV-hDlx-GqDREADD-dTomato-Fishell-4 hM3D(Gq) - Activation NLS-dTomato none 1, 9, rg* Gordon Fishell 50472 pAAV-GFAP-HA-rM3D... chemically induce neuronal activity in specific cell types. See our Chemogenetics Plasmids and Chemogenetics... -
Microbiology Resources
TypeCollection... Ralstonia solanacearum Rickettsia sp. Salmonella sp. Shigella sp. Staphylococcus sp. Streptococcus sp...Species Anabaena sp. Bacillus sp. Burkholderia sp. Bordetella pertussis Campylobacter sp. Chlamydia sp. Clostridium...reading frames for vaccinia virus - Bennink and Yewdell Labs Yarrowia lipolytica Golden Gate tool kit :...applications like recombinant protein purification and cell-free circuit design in E. coli - Freemont Lab MoClo-YTK... -
CRISPR Plasmids - Bacteria
TypeCollection...to activate programmed cell death or dormancy for phage-infected bacterial cells so as to limit the spread...sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ), a mechanism...PAM site. When a repair template is present, the cell may repair a DSB using homology-directed repair ...Cas protein and a target-specific gRNA in the same cell at the same time. Single plasmids containing both... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...abundant forms of posttranslational modification in cells and research into its many roles in protein function...interactions can be discovered by fluorescence-activated cell sorting (FACS). The Mode #2 phosphosite library ... Barber, K. W., Ter Haar, C. M., Rogulina, S., Amrofell, M. B., Isaacs, F. J., Rinehart, J., & Jewett,... production of recombinant phosphoproteins using cell-free protein synthesis . Nature Communications ,...TBK1 activation to promote mitophagy . Molecular Cell , 60 (1), 7–20. https://doi.org/10.1016/j.molcel... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...YPet-pBAD - Bacterial Expression ZsYellow1 529 539 8 Tetramer ZsYellow1-N1 - Mammalian Expression mPapaya1...allowing tracking of processes such as intracellular trafficking or cell cycle dynamics. Protein Excitation...Fluorescent Proteins: Empty Backbones Blue/UV Cyan Green Yellow Orange Red Far-Red Near-Infrared Long Stokes Shift...Cloning Vector - Mammalian Expression Return to top Yellow Protein Excitation (nm) Emission (nm) Brightness... -
Feng Zhang Multiplexed Overexpression of Regulatory Factors (MORF) Collection
TypeCollection...be used for screening transcription factors for cellular programming or cancer drug resistance....Zhang Lab Plasmids The Human TFome Library Stem Cells Protocols & References MORF Plasmids MORF Pooled...transcription factors for applications such as cellular programming or cancer drug resistance. Protocols...Fu Z, Macrae RK, Buenrostro JD, Regev A, Zhang F. Cell 2023 Jan 5; 186(1):209-229. PubMed (Link opens in... -
Cancer Research Plasmids and Resources
TypeCollection...important to normal cell signaling and physiology, and, when dysregulated, can enable cancer cell survival. Although...that is essential for regulating the growth of the cell. p53 p53, the most frequently mutated gene in human...somatic variants found in lung adenocarcinoma as well as variants found across cancer types as part of... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection...then be used to infect permissive cells that express ACE2, the cellular receptor for SARS-CoV-2, in a single...firefly luciferase to simultaneously measure the # of cells containing reactivated latent provirus and the overall...strength of viral transcriptional response in these cells. Warner Greene 105621 Lenti-luciferase-P2A-Neo Lentiviral... -
Synthetic Biology - Overview
TypeCollection...George Church Cynthia Collins James Collins Tom Ellis Drew Endy Tobias Erb Susan Golden John Gray Jeff... Keasling Taek Soon Lee Joshua Leonard Han Lim Wendell Lim Timothy Lu Michel Maharbiz Thorsten Mascher...Sensing and Signaling Browse plasmids related to intercellular signaling and environmental sensing. Strains... Circuit Transfer C. Collins Lab Quorum Sensing Ellis Lab GeneGuard Endy Lab Logic Gates , BIOFAB Promoter... -
Adenovirus Plasmids
TypeCollection...target a broad range of dividing and non-dividing cell types with almost 100% efficiency. Unlike lentiviruses...adenoviruses include transient transgene expression, as well as the substantial immune response induced by the...recombination of adenovirus plasmids in either mammalian cells or microorganisms, including bacteria and yeast....can then be transfected into mammalian packaging cell lines to generate adenovirus particles. Read our... -
Adeno-associated virus (AAV) Plasmids
TypeCollection...e.g., pHelper) and specific packaging cell lines (e.g., HEK293 cells) during AAV production. Read our AAV...AAV can transduce both dividing and non-dividing cells with a low immune response and low toxicity. Although...in-stock preps that are ready to ship right away, as well as our Packaged on Request service to give you more... -
Fluorescent Proteins: FRET
TypeCollection...and cloning backbones for red, yellow, and turquoise FRET pairs Gadella et al. (2023) mScarlet3: a brilliant...influenced by many factors, such as the organism or cell type, relative position and orientation of the fluorophores... (Unpublished) FRET Indicators - Live and Fixed Cells Additional Resources at Addgene Learn more on the... -
Validated gRNA Sequences
TypeCollection... 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC 58982 cut S. pyogenes 24879462 Mello AXIN2 H. sapiens... compiled from plasmids in Addgene's database as well as from sequences provided to us by users (see below...GAACCCGTTGCCGAATACAC 58202 cut S. pyogenes 24879462 Mello unc-58(e665) C. elegans TCCACGCACATGGTCACTA 59931...GGATGGATGTGTAGTCAATT 61250 cut S. pyogenes 25491644 Ward yellow D. melanogaster GGTTTTGGACACTGGAACCG 49331 cut ... -
Optogenetics AAV Preps
TypeCollection...-mDlx-ChR2-mCherry-Fishell-3 Dlx ChR2 mCherry Constitutive 1, 9, rg* Gordon Fishell 135634 pAAV-S5E2-ChR2...Optogenetics AAV Optogenetic tools can be used to control cell activity in living tissue with light. Optogenetics...Fluorophore GFP Red-wavelength fluorescent protein Yellow-wavelength fluorescent protein Blue-wavelength ... -
NETRF
TypeCollection... Modeling Neuroendocrine Tumors Using Adult Stem Cell-Derived Organoids Matthew Meyerson Dana-Farber Cancer...Institute Epigenetic Regulators of Intestinal Endocrine Cells and Carcinoid Tumors Qiao Zhou Harvard University...University Epigenetic Regulators of Intestinal Endocrine Cells and Carcinoid Tumors Bradley Bernstein Broad Institute...