Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 1,000 results for: Eras

Showing: 101 - 120 of 1000 results

  1. Worm Expression Resources

    Type
    Collection
    ...individually. CRISPR Read Addgene's CRISPR Guide for a general introduction to CRISPR technology. Addgene's worm...Jorgensen Lab. This kit contains 29 plasmids used to generate transgenic nematodes, including C. elegans and...Christian Frøkjær-Jensen's Wormbuilder website. General Tools Fire Lab C. elegans Vector Kit - Andrew Fire...plasmids - Paul Sternberg Lab. Plasmids for the temperature-robust GAL4-UAS system in C. elegans . Synthetic...

  2. NETRF

    Type
    Collection
    ...vision to accelerate scientific discovery that will help create new and more effective therapies for these...collaborative NET research community is pivotal in accelerating progress in the diagnosis and treatment of neuroendocrine...

  3. Fluorescent Protein Guide

    Type
    Collection
    ... Resources You May Also Like... Luminescence: Luciferase Plasmids Blog: Which FP Should I Use? Blog: How...pairs and standards to study protein-protein interactions or conformational changes within a protein. ...study individual plasmids or protein-protein interactions in organs and whole mammals. Regulate Biological...

  4. Fluorescent Protein Guide: In Vivo Imaging

    Type
    Collection
    ...study individual plasmids or protein-protein interactions in deep-tissue organs and whole mammals. Genetically...probes are suitable for stable imaging of protein interactions in living cells and live mice. Proteins for ...complementation probe used for detecting protein-protein interactions in vitro and in vivo . Learn more about in vivo...

  5. Chemogenetics Plasmids

    Type
    Collection
    ...actuator. When the luciferase enzyme oxidizes its substrate (luciferin), it generates light that activates...luminescent opsins: fusion proteins of a light-emitting luciferase and a light-sensing optogenetic element, making...

  6. Optogenetics Plasmid Collection

    Type
    Collection
    ...tool to control neuronal activity, scientists generally attach a fluorescent protein to the opsin in order... of proteins can also be controlled by light, generally by utilizing a light sensitive protein from cryptochromes...used as an optical switch to control protein interactions, dimerization, localization or activity of many...

  7. Resolute Plasmid Collection

    Type
    Collection
    ...quality of research output, RESOLUTE expects to accelerate the pace of research in the field of SLCs to ... deorphanizing engine. Genetic and proteomic interactions represent the framework that provides biological.... Protein production is used for assays and to generate antibody/ high-affinity ligands. Data is embedded...

  8. Mammalian RNAi Tools

    Type
    Collection
    ...siRNAs): mechanism, therapeutic targets, and delivery strategies for cancer therapy . International Journal... genes with potentially harmful mutations in therapeutic settings. As a tool in mammalian cell systems...

  9. CRISPR Plasmids and Resources

    Type
    Collection
    ...Cas enzymes generate double strand breaks (DSBs). Nick Mutated Cas nickase enzymes generate single-strand...promoting DSB formation. Delete NEW Cascade-Cas3 generates large genomic deletions. Insert NEW CRISPR transposases...

  10. New England Biolabs Cell-Imaging Plasmid Collection

    Type
    Collection
    ...England Biolabs has deposited plasmids at Addgene to generate SNAP, CLIP, ACP or MCP tagged plasmids for visualization... is based on the human O6-alkylguanine-DNA-alkyltransferase (hAGT), a DNA repair protein, and is suitable...and the ACP and SFP Synthases. Users may still generate their own fluorescent or non-fluorescent CoA substrates...

  11. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...disease in humans. For these reasons, AAVs are generally contained at lower biosafety levels and elicit...plasmids that are useful to produce AAV. In order to generate infectious AAV particles, a helper plasmid (encoding...Mutations PI AAV Plasmids This table contains a general list of plasmids that encode the AAV genome (i....

  12. Microbiology Resources

    Type
    Collection
    ...Resources for Microbiology General CRISPR Resources Read our CRISPR Guide for a general introduction to CRISPR...by Microbe System Plasmids for Archaea Species Haloferax sp. Methanococcus maripaludis Methanothermobacter...

  13. p53 Pathway

    Type
    Collection
    ...phosphorylation and acetylation, which disrupt its interaction with negative regulators, increase its stability...specific relationship. The content for this page was generated with the help of . Return to top p53 Pathway -...inhibitor 1 Bax BCL2-associated X protein Bid BH3 interacting domain death agonist CASP3 Caspase 3, apoptosis-related...

  14. Fluorescent Protein Guide: FRET

    Type
    Collection
    ...suitable for FRET experiments to measure protein interactions or conformation changes, as well as FRET standards...FRET is often used to study (1) protein-protein interactions where each protein is separately fused to a ...fluorescently tagged proteins to study protein-protein interactions and a series of FRET standards . Pre-constructed...

  15. Control AAV Preps

    Type
    Collection
    ...Constitutive 5, 8 Wilson 105532 pAAV.CMV.ffLuciferase.SV40 CMV ffLuciferase Constitutive 8 Wilson 105536 ...control AAV that express fluorescent proteins under general promoters. These AAV can be used to compare the...

  16. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Joung Multiplex gRNA Vectors Several systems have been developed to generate multiplex gRNA vectors. These...entries describing enzyme activity, experimental considerations, and more, created and maintained by the Doudna...Dicot Plants Plant PCR-based procedure to rapidly generate multiple sgRNA expression cassettes, which can...

  17. Revamp Your Lab Meetings With Creative Virtual Collaboration

    Type
    Blog Post
    ...colleagues can be more difficult during the pandemic era, with fewer opportunities for spontaneous conversations...creative interaction During Zoom meetings, different tools can be used to promote creative interaction. A great...here, and only general chatter will be allowed with a different host each time that moderates conversations...An example could be making lab meetings more interactive and creating space for discussion at the end ...end of each talk - time for free interaction and brainstorming. This could be achieved by asking each presenter...also make the screen-sharing experience more interactive. The button is on the right of the Share Screen...writing publications/grants too. As described by several works (Wuchty et al., 2007, Vicens et al., 2007...

  18. Even more elegant: Single injection CRISPR/Cas9 in C. elegans

    Type
    Blog Post
    ...methods for C. elegans were released, signaling a new era in C. elegans research. Homology directed repair ...CRISPR in C. elegans even easier - now, one can generate a fluorescent protein fusion, transcriptional ...efficient selection-based CRISPR/Cas9 method to generate knock-ins on any genetic background. Their new...flanking loxP sites and a heat-shock inducible Cre to generate a self-excising cassette (SEC). To make it possible...

  19. Validated gRNA Sequences

    Type
    Collection
    ...lC.GA4a B. oleracea GTTGAGAGGGGAGCCGGTGA 68256 cut S. pyogenes 26616834 Patron lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG...AGACGACCCTGTCATCCGCA 74188 cut S. pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737...

  20. Michael J Fox Foundation (MJFF) Plasmid Collection

    Type
    Collection
    ...research. This collection is part of Addgene's Neurodegeneration Research Collection , which includes other...Research Tools Labs affiliated with MJFF have also generated a number of Shared Research Tools (Link opens ...
Showing: 101 - 120 of 1000 results