We narrowed to 16 results for: Eras

... into different generations. Lentiviral Generations First-generation First-generation lentiviral plasmids... Figure 2: First-generation lentiviral plasmids. Second-generation Second-generation lentiviral plasmids...Figure 3: Second-generation lentiviral plasmids. Third-generation The third-generation system further improves...Second-generation Third-generation Transfer Plasmid Can be packaged ONLY by a second-generation packaging...order to facilitate immunotherapy and gene therapy. Biomedicine & Pharmacotherapy , 128 , 110276. https... All second-generation lentiviral transfer plasmids must be used with a second-generation packaging system...is often found in second-generation transfer plasmids as well. Third-generation plasmids include (Figure...

...potential applications for gene and cell-based therapies in the new era of personalized medicine . Genes & Diseases... table . Adenoviral Generations First-generation rAdV vectors The first generation of rAdV vectors was...Figure 2: First-generation rAdV vectors. Second-generation rAdV vectors Second-generation rAdV vectors contain...and third-generation rAdV vectors. Figure 3: Second-generation rAdV vectors. Third-generation rAdV vectors...formation is higher for first-generation rAdV vectors than later generations, which incorporate additional...creating first-generation rAdV vectors, which is still the most commonly used generation for research purposes...platforms within the gene therapy landscape . Signal Transduction and Targeted Therapy, 6 (1), 53. https://...

...they control the binding of the RNA polymerase to DNA. RNA polymerase transcribes DNA to mRNA, which is ... factors in order for RNA polymerase II (a eukaryote-specific RNA polymerase) to bind to a promoter. Transcription...promoter (which is recognized by the RNA polymerase), an operator (a segment of DNA in which a repressor...T7 RNA polymerase Sp6 Constitutive Promoter from Sp6 bacteriophage; requires Sp6 RNA polymerase lac Constitutive...is not unusual to have several regulatory elements, such as enhancers, several kilobases away from the... and contains the RNA polymerase binding site, TATA box, and TSS. RNA polymerase will stably bind to this...helps in the subsequent binding of the RNA polymerase. General transcription factors and histones (proteins...

...using dual nickases to generate a knockout or gene edit; or using Cas9 to generate large genomic deletions...proteins. Large deletions generated by Cas3 have fewer off-target alterations, such as small mutations ...nucleases (TALENs) required scientists to design and generate a new nuclease pair for every genomic target. ..., and precisely edit DNA and RNA. The ease of generating gRNAs makes CRISPR one of the most scalable genome...and some of the ways the CRISPR components are leveraged to achieve specific goals, such as targeting multiple...depends on which Cas protein you use, and there are several to choose from. Many variations of Cas9 exist, ...will form a ribonucleoprotein complex through interactions between the gRNA scaffold and surface-exposed...

...ideal for gene therapy, neuroscience research, and other biomedical fields. Gene Therapy One of the major...low risk of insertional mutagenesis. Several AAV-based gene therapies have been approved by the US Food ...AAV) as novel vectors for human gene therapy . Current Gene Therapy, 3 (4), 281–304. https://doi.org/10.2174...serotypes: vector toolkit for human gene therapy . Molecular Therapy, 14 (3), 316–327. https://doi.org/10.1016... cycle. AAVs are therefore non-pathogenic and generally do not trigger a strong immune response. These...preferred choice to be used as viral vectors for gene therapy applications. This guide contains many viral vector-specific...production. Genome Integration Recombinant AAVs are generally considered to not integrate into the host genome...

...want to: Generate complete and permanent loss of gene expression or function (knockout)? Generate a specific... for different organisms. This page provides a general framework to get you started using CRISPR in your...genetic edit. Figure 1: Flow chart describing the general framework of a CRISPR experiment. Created with ...Manipulation Application Cas Enzyme Additional Considerations Browse Plasmids Knockout Permanently disrupt...verified Cut Nick Homology Directed Repair (HDR) Generate specific genomic edits, like point mutations or...efficiency compared to NHEJ knockout Cut Nick Base Edit Generate specific base pair edits without double-strand...proximal to the PAM sequence Base Edit Prime Edit Generate targeted insertions, deletions, and point mutations...

...can be generated. The combination of a DNA fragment with a plasmid or vector DNA backbone generates a recombinant... DNA polymerase then binds to the single strand of DNA. Using this as a template, the polymerase migrates...Antibiotics DNA Sequencing Sanger Sequencing Next-generation Sequencing Long-read Sequencing Reference Tables...encode the same amino acid — a phenomenon called degeneracy. Refer to the amino acid table below for codon-amino...to work with — Plasmids are a convenient size (generally 1,000–20,000 base pairs) for physical isolation...elements are summarized in the table below. Figure 2: General structure of a plasmid. Plasmid Element Description...Site (MCS) A short segment of DNA which contains several restriction enzyme sites, enabling easy insertion...

...signaling molecules are horseradish peroxidase (HRP) and fluorophores. Horseradish peroxidase (HRP) HRP ...with several suitable antibodies; if they all meet your criteria, you may either purchase several to compare...epitopes on one antigen. Monoclonal antibodies are generated from cultured B cells, where each culture should...variability. Other Affinity Reagents There are several alternatives to antibodies, ranging from antibody... aliquots of at least 10 µL. Antibodies cannot tolerate freeze-thaw cycles. Here are a few tips for storing...a chemiluminescent reaction in the presence of several different substrates. The luminescence produced...Applications Antibody-based applications can be generally classed into four categories: Quantification -...

...-emitting luciferase fused to a light-sensing element such as an opsin. When the luciferase substrate ...substrate is added, the luciferase enzyme generates light that activates the opsin. While LMOs can also be activated...Scherffelia dubia 460 C1C2 ChR1-ChR2 chimera 470 ChIEF, ChEF, ChD Engineered chimeras of ChR1 and ChR2; increased...Singlet oxygen generator; can be used to disrupt cellular function or ablate cells local generation of reactive...illuminated. There are several different ways to control opsin expression. Generally, the most robust and...biomolecular processes with light. Light-activated tools generally fall into two main types: tools based on light-gated...electrical activity in a target cell type. OptoXRs are chimeras of a G-protein coupled receptor (GPCR) and an ...

... DNA topoisomerase I covalently bound to the phosphate group on the free 3' T. The topoisomerase acts ...exonuclease activity of T4 DNA polymerase. In LIC, the T4 DNA polymerase’s exonuclease activity creates ...allow you to move around pieces of DNA. Oftentimes several approaches will work for any specific cloning project... your research project . This guide highlights several of the most popular cloning methods for the creation...plasmids used for DNA cloning and expression contain several popular restriction enzyme sites, usually within...cloning. Created with BioRender.com. TOPO Cloning Toposiomerase-based cloning, often called TOPO cloning or ...and thymine (T). TOPO cloning utilizes the Taq polymerase, which naturally leaves a single A overhang on...

...used in gene therapy applications to more specifically direct delivery of gene therapies. Common Uses ...gamma-retroviral vectors. Gene Therapy Gamma-retroviral vectors are a popular choice in gene therapy applications. There...Gamma-retroviral vectors do not have defined “generations” of plasmids, as lentiviral vectors do. For more...line. For example, Phoenix™ is a popular second-generation gamma-retroviral packaging cell line developed...integration into a host’s genome. The process of generating stable cell lines with gamma-retroviral vectors...There are many approved gamma-retroviral gene therapies to treat disease like cancer or immunodeficiency...Delivery of chimeric antigen receptor T cell (CAR-T) therapy is a particularly popular application of gamma-...

...plant expression vectors containing several cassettes and generate multi-construct transgenic plants. ...designed with flexibility to allow for additional iterations of assembly. Combining multiple Level 2 vectors...Johannes Stuttmann 95 additional plasmids for hierarchical assembly of plant multigene constructs. MoClo...complementation experiments to analyze protein-protein interactions in plants. MoClo-YTK Yeast Expression John Dueber...characterized parts that can be used for bottom-up hierarchical assembly of single and multi-gene constructs...Yeast Expression Sylvestre Marillonnet Plasmids to generate transcription units for protein secretion in yeasts...Yeast Expression Elena Caro Bernat Plasmids for generating transcriptional units using the GoldenBraid system...

...light-emitting luciferase and a light-sensing optogenetic element. When the luciferase substrate (luciferin...luciferin) is added, the luciferase enzyme generates light that activates the opsin. The opsin may excite...on the type of luciferase used, the luciferin substrate may be the native coelenterazine (CTZ) or chemical...Addgene's Chemogenetics Plasmid Collection . Figure 1: General overview of a chemogenetics experiment. Early Chemogenetic...employed type of chemogenetic receptors. There are several different types of DREADDs that can be broadly ...Coupling brighter bioluminescent modules, such as luciferase-fluorescent protein fusions, to more-sensitive...Descriptions of LMOs and their activity in neurons LMO Luciferase Opsin Ligand Effect Outcome Reference LMO3 sbGLuc...

...Genome-wide coverage possible Well-validated libraries Compatible with pooled next generation sequencing...specialized systems Limited to extracellular interactions or display-compatible proteins cDNA/ORF Overexpression...or target gene. Positive selection screens are generally very robust, and tens of thousands of genes that...were initially present may be narrowed down to several hundred or fewer. Negative screen: Apply library...results between experimental and control cells Generate a list of library plasmids that disappear with...growth/survival under certain conditions. Next-Generation Sequencing NGS allows for parallel sequencing...Library Amplification Protocol for Addgene's generalized library amplification protocol. Read our CRISPR...

...AGTCAAGTAACAACCGCGA 3' end of luciferase Forward LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase Reverse M13 Forward...Sequencing Primers Though Addgene mainly uses next-generation sequencing (NGS) for plasmid verification, Addgene...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward pGP704-R AACAAGCCAGGGATGTAACG R6K gamma...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase Forward RVprimer3 CTAGCAAAATAGGCTGTCCC 5' of ...

...and management, resources for identifying your transferable skills, and tips on the job application process...