Skip to main content

We narrowed to 877 results for: HA

Showing: 101 - 120 of 877 results
  1. Protocol - How to Design Primers

    Type
    Protocol
    ...the 3’ end, and the 5’ end of the primer usually has stretches of several nucleotides. Also, both of the...
  2. Sequencing Primers

    Type
    Guide
    ...promoter Forward HA-F TACCCATACGACGTCCCAGA HA tag Forward HA-R TCTGGGACGTCGTATGGGTA HA tag Reverse HAT ...sequencing (NGS) for plasmid verification, Addgene has used a number of primers for Sanger sequence verification...
  3. Chemogenetics Guide

    Type
    Guide
    ...studies, however, it has off-target effects. The atypical antipsychotic drug olanzapine has also been shown...is based on the human M3 muscarinic receptor and has not been used in vivo. Figure 2: DREADDs, their ligands...for muscarinic-receptor based DREADDs. Compound 21 has similar potency as CNO, while DCZ is more potent ...attractive alternatives for experiments. Perlapine has been previously used in human populations in Japan...luciferase-fluorescent protein fusions, to more-sensitive opsins has led to improved LMOs with increased efficiencies....
  4. HA Frankenbody, a New Imaging Tool to Visualize Single Molecules and Nascent Peptides

    Type
    Blog Post
    ... the HA frankenbody? Another large advantage of the HA frankenbody is that it remains bound to HA epitopes...feature provides HA frankenbody the ability to bind nascent HA tagged proteins.  Lastly, the HA frankenbody...the widely used HA epitope in diverse cellular environments. They called this probe the HA frankenbody (... towards a HA epitope from the CDRs.  To visualize proteins of interest tagged with the HA epitope, the...spaghetti monster HA (smHA) which contains a 10xHA tag. These experiments demonstrated that the HA frankenbody...localization of single HA-tagged molecules over time.  The Stasevich lab also proved that HA frankenbody can ...proteins.  Limitations with GFP in imaging  While GFP has been an immensely powerful tool to study proteins...
  5. CRISPR Guide

    Type
    Guide
    .... Cas9 nickase (Cas9n), a D10A mutant of SpCas9, has one active nuclease domain and one inactivated one... available. SaCas9 (from Staphylococcus aureus ) has a coding sequence ~1 kb shorter than SpCas9 while... SpCas9. FrCas9 (from Faecalibaculum rodentium ) has increased fidelity, and recognizes NNTA, a PAM sequence... create the adenine base editor. The TadA domain has also been further evolved to catalyze cytidine deamination...editing requires more optimization and typically has lower efficiency (< 50%) than base editing (> 90%...modifications to eliminate target gene function. It has also been used extensively to screen for novel genes... those for yeast or Drosophila . Although CRISPR has been less widely used in bacteria due to technical...
  6. Antibody Validation Using the Indirect ELISA Method

    Type
    Protocol
    ...periodically to determine when the desired color change has occurred. The color will change from yellow to blue...experimental conditions. When the desired color change has occurred, gently remove the plate seal. Using a multichannel...
  7. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...vector is the backbone upon which The RNAi Consortium has built a library of shRNAs directed against 15,000...shRNA insert. The original pLKO.1-TRC cloning vector has a 1.9kb stuffer that is released by digestion with... the sequencing conditions if the DNA polymerase has difficulty reading through the secondary structure... in contact with the walls of the tube before it has been diluted. Mix by swirling or gently flicking ...
  8. The Blue Flame Award: Celebrating Addgene's Most Requested Depositors

    Type
    Blog Post
    ...indicates that a plasmid has been requested 20+ times   A red flame means a plasmid has been requested 50+ ... Castro of University of Michigan says, “Addgene has transformed the way in which we share plasmids and...making it easier, cost effective and faster; this has helped accelerate scientific discoveries.” Occasionally...+ times   A blue flame means a plasmid has been requested 100+ times Since we so sincerely appreciate ...have at least one plasmid deposited at Addgene that has been distributed more than 100 times. We hope these...sharing because, as UNC’s Bryan Roth says, Addgene has “literally enabled sharing with 100's of investigators...popularity of CRISPR in the plant community, this has saved us hours of work responding to requests from...
  9. RANbodies: Reporter Nanobody Fusions

    Type
    Blog Post
    ...discussed in more detail below. The HA tag can be stained for with an anti-HA antibody and serves as a backup...detected either with a labeled anti- HA or -MYC antibody or with an anti-HA or -MYC primary and a labeled secondary...Gelsolin Spaghetti Monster: HA (H) or Myc (M) versions Labeled anti-HA or -Myc antibody Staining cultured...detectable by two different tags: a reporter and an HA tag. The reporter comes in three varieties: HRP, ...independent of the reporter. The only caveat is that HA staining is weaker than reporter staining. Picking...Spaghetti Monsters are highly antigenic tags that have 10 HA or 10 MYC tags built into a GFP scaffold. Some GFP...recognize this GFP scaffold itself. Fortunately the GFP1 HA Spaghetti Monster RANbody doesn’t recognize the scaffold...
  10. Antibody Guide

    Type
    Guide
    ... immune response to it. Once the immune response has developed, the antibodies are collected, tested against...epitopes on constant regions of other antibodies. This has useful research applications, and is covered in the...exist as monomers. Each antibody class therefore has a valency, or number of binding sites available per...of antibodies multiplied by two, as each antibody has two binding sites. Isotype Description Configuration... must be able to detect if and where an antibody has bound. Signaling molecules , proteins that emit a...to avoid confusing data. Check that your machine has appropriate lasers and filters for each fluorophore...
  11. New CRISPR Web Resources and #12DaysofCRISPR Recap

    Type
    Blog Post
    ...base editor pCMV-BE3 has been requested nearly 400 times, and newcomer pCMV-ABE7.10 has already earned a ... CRISPR has made it possible to design programmable epigenome editing tools, and the field has certainly...Since the start of the CRISPR revolution, Addgene has distributed over 100,000 CRISPR plasmids. But that...have available by category. Each plasmid page now has a helpful graphic to introduce you to the plasmid... the Transcriptional Regulation category already has five blue flame plasmids covering three different...LwCas13a guide expression backbone with U6 promoter has already earned a blue flame. RNA Editing: Did anyone...
  12. Antibodies 101: Epitope Tags

    Type
    Blog Post
    ...Addgene has you covered with monoclonal antibodies to Myc for all of these species. HA The HA tag is ... The tag has two negatively charged amino acids for an overall negative charge. This tag has been used...charged and 2 positively charged amino acids. FLAG tag has been used with moderate to high success rates across...from the protooncogene of the same name. The tag has a net negative charge with 4 negatively charged and...antibody can’t be used or that step can be skipped. It has the flexibility of also being used for immunoprecipitation...antibodies or guidance on designing a GFP tag Addgene has you covered!   Potential tag issues Tags have a lot...
  13. Mesothelioma - Causes, Symptoms, and Treatment

    Type
    Blog Post
    ...misdiagnosed, meaning that by the time it has caught it has usually started to spread (metastasize) and...and treatments such as these has brought a lot of promise to a field that has historically been full of ...have spread while Stage 4 indicates that the cancer has spread from where it originated to another organ ...However, as the U.S. Environmental Protection Agency has noted, there is no safe level of asbestos exposure...abdominal cavity. This targeted chemotherapy approach has been shown to be successful in killing many (if not...patients: early detection and immunotherapy.  It has long been known that one of the best ways to improve...standard treatments and early detection, mesothelioma has proven itself to be susceptible to up and coming ...
  14. Five Popular Model Organisms, Part 2

    Type
    Blog Post
    ... an essential aspect of biological research that has defined our understanding of biological processes...model organisms is Escherichia coli. The bacterium has been used as a model organism for over 60 years with...cloning and metabolic engineering.  The E. coli genome has an extensive research history and characterization...studies. For example the E. coli biotin ligase, BirA, has been used to identify and study protein-protein interactions...APEX (Rhee et al., 2013). Research using E. coli has the potential to address many areas of microbial ...research with an archive of information and data that has yet to be produced with mice (Iannaccone et al., ..., 2009). While the rat as a model organism has its perks, it is far from perfect. One of the most limiting...
  15. Addgene Welcomes John Doench to the Advisory Board

    Type
    Blog Post
    ...Doench has been working on developing CRISPR pooled libraries for use in genetic screens and has contributed...Perturbation Platform at the Broad Institute and has worked with many Addgenies to help improve the understanding... time here, this is an incredible place.” Doench has spent most of his research career working on miRNAs...Platforms with a capital ‘P’ focused on technology ... has been critical to the Broad’s success over the last...with David Root in the then RNAi Platform, which has since evolved into the Genetic Perturbation Platform...of CRISPR, the hype was completely justified… it has been just an incredibly useful technology.” He goes...known of Addgene basically since the beginning and [has] been using Addgene ever since” and that he’s “very...
  16. Early Career Researcher Toolbox: Free Tools for Making Scientific Graphics

    Type
    Blog Post
    ...the software. The Inkscape website has many tutorials and Lynda has a tutorial as well, which you may ...to draw figures. It’s part of Google Drive so it has a similar interface as Google Docs or other products...create graphics for the Addgene blog. However, it has a limited number of drawing tools, so it’s harder...web and a desktop version of this software. Vectr has layers, which let you lock and hide individual vectors..., Mac OS X, and Linux. Inkscape is versatile and has a wide selection of tools for drawing and editing... team & I have poured our hearts into for 2 yrs) has 200K+ figures by 95K+ scientists 👨🏽‍🔬👩‍🔬! We...May 22, 2019 Smart Servier Medical Art This site has 3,000 free medical images organized into four main...
  17. CRISPR 101: Drug discovery and CRISPR

    Type
    Blog Post
    ...the target. CRISPR has revolutionized the generation of knockout cell lines which has made this control...In this blog we will review how CRISPR technology has brought drug and genetic screens together and expedited...candidate genes! Disease model generation CRISPR has made the generation of genome edits accessible, fast... have the precise disease genetics. Since CRISPR has been adapted for use in primary cells, many tissue...drug is equally toxic to both lines, it probably has either high toxicity or high off target effects, ...  CRISPR and drugs in the future While CRISPR has already done a lot for drug discovery, there is more...engineered to have many unique capabilities which has advanced what type of edits can be made in the contexts...
Showing: 101 - 120 of 877 results