Skip to main content

We narrowed to 941 results for: INA

Showing: 101 - 120 of 941 results
  1. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...guanosine. RNA editors : Cas13 fused to the ADAR2 deaminase convert adenosine to inosine on RNA. Inosine is..., Davidson AR. 2013. Bacteriophage genes that inactivate the CRISPR/Cas bacterial immune system. Nature...Cell . 154(2):442-51. PMID: 23849981 Ishino Y, Shinagawa H, Makino K, Amemura M, Nakata A. 1987. Nucleotide...
  2. Antibodies

    Type
    Collection
    ...Overview of Addgene's ready-to-use monoclonal recombinant antibody collection. These affinity reagents ... Antibodies Addgene distributes ready-to-use recombinant antibodies to help facilitate scientific research...
  3. CRISPR Plasmids - Purify Genomic Loci

    Type
    Collection
    ...Catalytically inactive CRISPR plasmids for purification of target loci.... molecule-mediated ChIP) system, catalytically inactive dCas9 is used to purify genomic DNA bound by the...
  4. Structural Genomics Consortium Plasmids

    Type
    Collection
    ...Expression vector for secreted proteins with N-terminal hexahistidine tag and TEV cleavage, Bac-to-Bac...Expression vector for secreted proteins with C-terminal hexahistidine tag and TEV cleavage, Bac-to-Bac...
  5. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ...a ntiviral de fense) complex, comprised of a combination of Cas5, Cas6, Cas7, Cas8, and Cas11. Cascade...non-specifically along the way. Cas3 initiates a final double-strand break, either due to a boundary defined...
  6. Resolute Plasmid Collection

    Type
    Collection
    ...partnership of 13 members from industry and academia financed by the Innovative Medicine Initiative (IMI) of...Figure 1: Representation of RESOLUTE mission. The combination of metabolomics and genome engineering forms ...
  7. Zinc Finger Consortium: OPEN Reagents

    Type
    Collection
    ...Information Protocols & Resources Contents of Kit Original Publication Oligomerized pool engineering (OPEN...tools for using the bacterial two-hybrid system originally described by Hochschild and colleagues ( Dove...
  8. Malate Dehydrogenase CUREs Community Collection

    Type
    Collection
    ...institutions. With these plasmids, faculty can begin a sustainable MDH-related CURE focusing on protein expression...experiences (CURE) impacts student learning and attitudinal outcomes: A study of the Malate dehydrogenase...
  9. Adenovirus Plasmids

    Type
    Collection
    ...the most common of which involves homologous recombination of adenovirus plasmids in either mammalian cells...Strain Description PI 16398 BJ5183 Strain for recombination between shuttle plasmid and adenoviral plasmid...
  10. CRISPR Plasmids - Yeast

    Type
    Collection
    ... Catalytically dead dCas9 fused to a cytidine deaminase protein becomes a specific cytosine base editor...Selectable Marker PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used to purify a region of...
  11. Viral Vector Guides and Plasmids

    Type
    Collection
    ...–36 kb 105 nm Dividing/Non-dividing No High *Recombinant AAV has a low frequency of target cell genome...multi-plasmid system. Many viral plasmids are also self-inactivating, meaning that they can only complete one round...
  12. Microbiology Resources

    Type
    Collection
    ...and Dutzler Labs EasyClone 2.0 Yeast Toolkit - Borodina Lab Golden GATEway cloning system - Wittbrodt ...MoClo : Modular cloning for applications like recombinant protein purification and cell-free circuit design...
  13. Worm Expression Resources

    Type
    Collection
    .... elegans by combining expression of the FLP recombinase from either a heat-shock promoter or a tissue-specific...WormBook - A comprehensive, open-access collection of original, peer-reviewed chapters covering topics related...
  14. CRISPR Plasmids - Bacteria

    Type
    Collection
    ... Catalytically dead dCas9 fused to a cytidine deaminase protein becomes a specific cytosine base editor...Promoter PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used to purify a region of...
  15. TALEN Guide

    Type
    Collection
    ...TALEN Kits CRISPR Plasmids Zinc Finger Consortium Originally published in Addgene's December 2011 Newsletter...Bogdanove Golden Gate TALEN kit. In this example, the final array is composed of 18 TAL effector repeats. The...
  16. Fluorescent Proteins: FRET

    Type
    Collection
    ...tdTomato-N1 CyOFP1* mCardinal 497 0.76 659 87,000 0.19 6.7 6.5 pNCS-CyOFP , mCardinal-N1 mAmetrine* tdTomato...
  17. Lentivirus Plasmids

    Type
    Collection
    ...Cheng 17452 pLenti CMV Puro DEST 3rd Gateway destination plasmid with constitutive or inducible expression...Fraser 15948 pLOVE 3rd Tet inducible gateway destination plasmid for cDNA expression. Miguel Ramalho-Santos...
  18. Plan Your Experiment

    Type
    Collection
    ...RNA (gRNA), the design of the gRNA sequence, and finally how to validate your genetic edit. Figure 1: Flow...expression with AAVs can be long-lived, despite recombinant AAVs not integrating into the host genome. Scientists...
  19. Validated gRNA Sequences

    Type
    Collection
    ... 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740...pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740...
Showing: 101 - 120 of 941 results