We narrowed to 934 results for: Ina
-
TypeCollection...9N7polA (CT) 9 degrees N-7 DNA Polymerase chain terminating 165511 pOpen-K12polLF DNA Polymerase I, Large...methyltransferase 165520 pOpen-T4 PNK T4 PNK polynucleotide kinase 165521 pOpen-lambda red operon lambda red operon...pOpen-BovDNTT Bovine DNTT 165555 pOpen-ALPI CIP (calf intestinal phosphatase) Return to top Additional Resources...
-
COVID-19 Resources
TypeCollection... found on this page: SARS-CoV-2 Antibodies : Recombinant monoclonal antibodies that target SARS-CoV-2 ... Nucleocapsid Protein [mBG17] - Clone mBG17, recombinant mouse monoclonal antibody targeting the SARS-... Nucleocapsid Protein [mBG86] - Clone mBG86, recombinant mouse monoclonal antibody targeting the SARS-... -
CRISPR History and Development for Genome Engineering
TypeCollection...guanosine. RNA editors : Cas13 fused to the ADAR2 deaminase convert adenosine to inosine on RNA. Inosine is..., Davidson AR. 2013. Bacteriophage genes that inactivate the CRISPR/Cas bacterial immune system. Nature...Cell . 154(2):442-51. PMID: 23849981 Ishino Y, Shinagawa H, Makino K, Amemura M, Nakata A. 1987. Nucleotide... -
Antibodies
TypeCollection...Overview of Addgene's ready-to-use monoclonal recombinant antibody collection. These affinity reagents ... Antibodies Addgene distributes ready-to-use recombinant antibodies to help facilitate scientific research... -
TALEN Expression Vectors
TypeCollection...assembly are different among the three methods, the final products are the same). All expression vectors listed...Sander et al., Nat Biotechnol. 2011 ): ID Plasmid C-terminal 0.5 TALE repeat Binds 32285 JDS70 NI RVD A 32287... -
CRISPR Plasmids - Purify Genomic Loci
TypeCollection...Catalytically inactive CRISPR plasmids for purification of target loci.... molecule-mediated ChIP) system, catalytically inactive dCas9 is used to purify genomic DNA bound by the... -
Structural Genomics Consortium Plasmids
TypeCollection...Expression vector for secreted proteins with N-terminal hexahistidine tag and TEV cleavage, Bac-to-Bac...Expression vector for secreted proteins with C-terminal hexahistidine tag and TEV cleavage, Bac-to-Bac... -
CRISPR Plasmids - Cascade-Cas3
TypeCollection...a ntiviral de fense) complex, comprised of a combination of Cas5, Cas6, Cas7, Cas8, and Cas11. Cascade...non-specifically along the way. Cas3 initiates a final double-strand break, either due to a boundary defined... -
Resolute Plasmid Collection
TypeCollection...partnership of 13 members from industry and academia financed by the Innovative Medicine Initiative (IMI) of...Figure 1: Representation of RESOLUTE mission. The combination of metabolomics and genome engineering forms ... -
Zinc Finger Consortium: OPEN Reagents
TypeCollection...Information Protocols & Resources Contents of Kit Original Publication Oligomerized pool engineering (OPEN...tools for using the bacterial two-hybrid system originally described by Hochschild and colleagues ( Dove... -
Malate Dehydrogenase CUREs Community Collection
TypeCollection...institutions. With these plasmids, faculty can begin a sustainable MDH-related CURE focusing on protein expression...experiences (CURE) impacts student learning and attitudinal outcomes: A study of the Malate dehydrogenase... -
Adenovirus Plasmids
TypeCollection...the most common of which involves homologous recombination of adenovirus plasmids in either mammalian cells...Strain Description PI 16398 BJ5183 Strain for recombination between shuttle plasmid and adenoviral plasmid... -
CRISPR Plasmids - Yeast
TypeCollection... Catalytically dead dCas9 fused to a cytidine deaminase protein becomes a specific cytosine base editor...Selectable Marker PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used to purify a region of... -
Microbiology Resources
TypeCollection...and Dutzler Labs EasyClone 2.0 Yeast Toolkit - Borodina Lab Golden GATEway cloning system - Wittbrodt ...MoClo : Modular cloning for applications like recombinant protein purification and cell-free circuit design... -
Worm Expression Resources
TypeCollection.... elegans by combining expression of the FLP recombinase from either a heat-shock promoter or a tissue-specific...WormBook - A comprehensive, open-access collection of original, peer-reviewed chapters covering topics related... -
CRISPR Plasmids - Bacteria
TypeCollection... Catalytically dead dCas9 fused to a cytidine deaminase protein becomes a specific cytosine base editor...Promoter PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used to purify a region of... -
TALEN Guide
TypeCollection...TALEN Kits CRISPR Plasmids Zinc Finger Consortium Originally published in Addgene's December 2011 Newsletter...Bogdanove Golden Gate TALEN kit. In this example, the final array is composed of 18 TAL effector repeats. The... -
Lentivirus Plasmids
TypeCollection...Cheng 17452 pLenti CMV Puro DEST 3rd Gateway destination plasmid with constitutive or inducible expression...Fraser 15948 pLOVE 3rd Tet inducible gateway destination plasmid for cDNA expression Ramalho-Santos 24129... -
Plan Your Experiment
TypeCollection...RNA (gRNA), the design of the gRNA sequence, and finally how to validate your genetic edit. Figure 1: Flow...expression with AAVs can be long-lived, despite recombinant AAVs not integrating into the host genome. Scientists... -
Validated gRNA Sequences
TypeCollection... 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740...pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740...