We narrowed to 931 results for: Por
-
TypeCollection... of p53’s pro-apoptotic effects is especially important to tumorigenesis. Inheriting only one functional...
-
Lentiviral Prep Service
TypeCollection...on each item's material page. Actual titers are reported with each shipment. For more details about our... -
CRISPR Plasmids - Tagging
TypeCollection...with the following article: Natsume, et al. Cell Reports 2016 Förstemann Drosophila Cell Tagging System ... -
Brain Armamentarium
TypeCollection...function. Browse plasmids or viral preps created with support from the BRAIN Armamentarium Project below. Plasmids... -
Caltech Systemic Capsids
TypeCollection...tropism exhibited by the PHP.eB serotype has been reported to occur by using the cellular receptor LY6A (... -
CRISPR History and Development for Genome Engineering
TypeCollection...libraries can be used to identify genes that are important to a given phenotype. Current libraries are available... -
Zhang Lab CRISPR Page
TypeCollection...nucleolytically inactive Cas9-VP64 fusion A sgRNA incorporating two MS2 RNA aptamers at the tetraloop and stemloop... -
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection...expression from mouse to primate neocortex. Cell Reports , 34 (13), 108754. https://doi.org/10.1016/j.celrep... -
Validated gRNA Sequences
TypeCollection...pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate ... -
Molecular Biology Reference
TypeGuide...technologies, like Nanopore, can read thousands to potentially millions of base pairs at a time. Nanopore uses specialized...stand is pulled through the pores. An electrical current runs through the porous membrane, and the changes...Additional Resources Plasmids are one of the most important tools in molecular biology. They allow scientists...study and have led to the understanding of many important molecular pathways and diseases. Here we present...transcribed into non-coding RNA (ncRNA) and play important roles in cellular processes and gene regulation...TALEN Plasmids and Kits , Genome Engineering Kits Reporter Plasmids Used for studying the function of genetic...genetic elements. These plasmids contain a reporter gene (e.g., luciferase or GFP) that offers a readout... -
Adeno-associated virus (AAV) Guide
TypeGuide... to display neuronal retrograde transport, AAVrg. Retrograde transport refers to the direction of movement...nuclear export. Poly(A) signal in cis The polyadenylation or poly(A) signal aids in the nuclear export of ...soma to axon) and retrograde (from axon to soma) transport. Many rAAV vectors have been engineered to express...viral element necessary for RABV trans-synaptic transport. Learn more about these and other initiatives ...the transgene. The first vector contains the 5' portion of the gene and a splice donor sequence at its ...3' end, while the second vector carries the 3' portion of the gene with a splice acceptor sequence at ...viruses from the Parvoviridae family. Anterograde transport Movement of molecules, vesicles or organelles ... -
Plan Your Experiment
TypeGuide...testing multiple pegRNA designs is particularly important for prime editing. CRISPR Intereference : Target...Predicted On-Target and Off-Target Activity Another important factor to keep in mind when designing your gRNA...In addition to off-target activity, it is also important to consider factors that maximize cleavage of ...generally perform by chemical transfection or electroporation. Expression can be transient, or you can generate... to target cells through microinjection or electroporation. The target cells translate the mRNA encoding...delivery the RNP to cells using cationic lipids, electroporation, or an endosomal approach. Similar to the mRNA... breaks will be repaired by NHEJ instead of incorporating your desired edit through HDR. Base and prime... -
Optogenetics Guide
TypeGuide...neural populations at distinct times. Temporal considerations Temporal precision is key in optogenetic experiments... exposed to light of the correct wavelength, the pore opens, cations flow into the cell (yellow dots),...of proteins) and sensors (genetically-encoded reporters of molecular signals). These areas have each since...specific subsets of neurons, allowing precise spatiotemporal control of these neurons by turning on and ...addition of trafficking signal from Kir2.1 and ER export signal provide improved membrane targeting 589 ...the vesicular gamma aminobutyric acid (GABA) transporter (VGAT) and ChR2 is thus expressed in all GABAergic...photoswitchable" proteins offer exquisite spatial and temporal control of protein activity. Phytochrome, cryptochrome... -
CRISPR Guide
TypeGuide...and a ssDNA-fluorescently quenched reporter is added. As this reporter is degraded by Cas12a, it will release... using a fluorescent reporter. In SHERLOCK, a quenched ssRNA fluorescent reporter is added to the reaction...insertions. When designing the donor template, incorporating mutations that prevent further Cas9 cleavage...Overview of HDR. In most applications, a large portion of the Cas9-induced DSBs will still be repaired...the desired HDR-edited allele. Therefore, it is important to confirm the presence of the desired edit experimentally...pairs to the 3’ flap, and the desired edit is incorporated into the DNA by reverse transcription. The edited...applications where orientation of the insert is important. However, type I-F CASTs favor insertion in the... -
Antibody Guide
TypeGuide...necessary in cases where extreme specificity is important. Their epitope specificity allows binding to a...antibodies only bind a single epitope, so it is important to choose a monoclonal antibody that will recognize...using a secondary against a tag, such as His, incorporated in the sdAb. sdAbs can have weak signals due...with conjugating reactions are possible. It is important to research your reaction and buffer before conjugating... the basic steps needed for each application, important controls, and any special considerations to think...which are bacterial proteins that bind to the Fc portion of an antibody. However, they are not suitable ... assay, selection of the fluorophores used is important. It is best to inversely pair the brightness of... -
Lentiviral Vector Guide
TypeGuide...transcription of the full-length virus after it is incorporated into a host genome. This is often found in second-generation...cells, they kill off any cells that have not incorporated the lentiviral genome and the cells that survive...the only type of selectable marker. Fluorescent reporters, such as GFP, are another common selection marker...interest and contains the sequences that will be incorporated into the host cell genome but cannot produce...after one round of reverse transcription. After incorporation into a host cell, this deletion prevents further... expression of transgenes via increased nuclear export. RRE in cis Rev Response Element; the sequence ...partially spliced transcripts to facilitate nuclear export. Provided by a separate plasmid from gag/pol in... -
Chemogenetics Guide
TypeGuide...control expression of a chemogenetic reporter ensures that the reporter remains silent until a cell or tissue-specific...ligands can have high potency, which is potentially important for dosing in animal studies, made them attractive...agonists for PSAM4. A given PSAM is coupled with an ion pore domain (IPD) to form ligand-gated ion channels (...signaling. PSAM-based LGICs can be classified by the ion pore domain they are coupled to: PSAM-Gly PSAM-Gly LGICs... of PSAMs and their activity in neurons PSAM Ion Pore Domain Ligand(s) Effect Outcome (in neurons) Reference... -
Promoters
TypeGuide...Common Bacterial Promoters Researchers often incorporate the following promoters into plasmids to drive...transcription of a given gene. There are three main portions that make up a eukaryotic promoter: the core promoter...make up the transcription complex. The most 3' portion (closest to the gene's start codon) of the core...transcription factors bind. Distal Promoter The final portion of the promoter region is called the distal promoter...Common Eukaryotic Promoters Researchers often incorporate the following promoters into plasmids to drive... -
Gamma-Retroviral Vector Guide
TypeGuide...cells, they kill off any cells that have not incorporated the retroviral genome and the cells that survive...the only type of selectable marker. Fluorescent reporters, such as GFP, are another common selection marker...interest and contains the sequences that will be incorporated into the host cell genome but cannot produce...after one round of reverse transcription. After incorporation into a host cell, this deletion prevents further... expression of transgenes via increased nuclear export. Psi (Ѱ) in cis RNA packaging signal; recognized... -
Guide to Using Pooled Libraries
TypeGuide...can help you begin to understand what genes are important to a certain phenotype, and allow you to design...the screening process. Amplify the library (electroporation and maxiprep). If delivering as virus, make...die or do not pass selection (in the case of a reporter) Sort “winning” cells Sequence those cells that...