Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 921 results for: Por

Showing: 101 - 120 of 921 results

  1. p53 Pathway

    Type
    Collection
    ... of p53’s pro-apoptotic effects is especially important to tumorigenesis. Inheriting only one functional...

  2. Lentiviral Prep Service

    Type
    Collection
    ...on each item's material page. Actual titers are reported with each shipment. For more details about our...

  3. Viral Vectors

    Type
    Collection
    ...for long term studies) while other viruses are temporary in the host. Use this guide to learn more about...

  4. Brain Armamentarium

    Type
    Collection
    ...function. Browse plasmids or viral preps created with support from the BRAIN Armamentarium Project below. Plasmids...

  5. CRISPR Plasmids - Tagging

    Type
    Collection
    ...with the following article: Natsume, et al. Cell Reports 2016 Förstemann Drosophila Cell Tagging System ...

  8. Caltech Systemic Capsids

    Type
    Collection
    ...tropism exhibited by the PHP.eB serotype has been reported to occur by using the cellular receptor LY6A (...

  10. Zhang Lab CRISPR Page

    Type
    Collection
    ...nucleolytically inactive Cas9-VP64 fusion A sgRNA incorporating two MS2 RNA aptamers at the tetraloop and stemloop...

  11. Validated gRNA Sequences

    Type
    Collection
    ...pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate ...

  12. Molecular Biology Reference

    Type
    Guide
    ...be copied (amplified) by bacteria, which is an important characteristic of why plasmids are convenient ...would not survive antibiotic treatment. It is important to distinguish that the antibiotic resistance ...promoter). The strength of the promoter is also important for controlling the level of insert expression...information on CRISPR check out Addgene’s CRISPR guide . Reporter Plasmids - Used for studying the function of genetic... genetic elements. These plasmids contain a reporter gene (for example, luciferase or GFP) that offers...certain diseases. Sequencing DNA is extremely important when verifying plasmids to ensure each plasmid...vitro DNA replication but relies on the random incorporation of modified, fluorescently tagged bases onto...

  13. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ... to display neuronal retrograde transport, AAVrg. Retrograde transport refers to the direction of movement...nuclear export. Poly(A) signal in cis The polyadenylation or poly(A) signal aids in the nuclear export of ...soma to axon) and retrograde (from axon to soma) transport. Many rAAV vectors have been engineered to express...viral element necessary for RABV trans-synaptic transport. Learn more about these and other initiatives ...the transgene. The first vector contains the 5' portion of the gene and a splice donor sequence at its ...3' end, while the second vector carries the 3' portion of the gene with a splice acceptor sequence at ...viruses from the Parvoviridae family. Anterograde transport Movement of molecules, vesicles or organelles ...

  14. Optogenetics Guide

    Type
    Guide
    ...neural populations at distinct times. Temporal considerations. Temporal precision is key in optogenetic experiments... exposed to light of the correct wavelength, the pore opens, cations flow into the cell (yellow dots),...optical switches Sensors are genetically-encoded reporters of molecular signals; e.g., calcium indicators...specific subsets of neurons, allowing precise spatiotemporal control of these neurons by turning on and ...addition of trafficking signal from Kir2.1 and ER export signal provide improved membrane targeting 589 ...the vesicular gamma aminobutyric acid (GABA) transporter (VGAT) and ChR2 is thus expressed in all GABAergic...photoswitchable” proteins offer exquisite spatial and temporal control of protein activity. Phytochrome, cryptochrome...

  15. CRISPR Guide

    Type
    Guide
    ...and a ssDNA-fluorescently quenched reporter is added. As this reporter is degraded by Cas12a, it will release... using a fluorescent reporter. In SHERLOCK, a quenched ssRNA fluorescent reporter is added to the reaction...insertions. When designing the donor template, incorporating mutations that prevent further Cas9 cleavage... HDR efficiency. In most applications, a large portion of the Cas9-induced DSBs will still be repaired...the desired HDR-edited allele. Therefore, it is important to confirm the presence of the desired edit experimentally...pairs to the 3’ flap, and the desired edit is incorporated into the DNA by reverse transcription. The edited...applications where orientation of the insert is important. However, type I-F CASTs favor insertion in the...

  16. Antibody Guide

    Type
    Guide
    ...necessary in cases where extreme specificity is important. Their epitope specificity allows binding to a...antibodies only bind a single epitope, so it is important to choose a monoclonal antibody that will recognize...using a secondary against a tag, such as His, incorporated in the sdAb. sdAbs can have weak signals due...with conjugating reactions are possible. It is important to research your reaction and buffer before conjugating... the basic steps needed for each application, important controls, and any special considerations to think...which are bacterial proteins that bind to the Fc portion of an antibody. However, they are not suitable ... assay, selection of the fluorophores used is important. It is best to inversely pair the brightness of...

  17. Plan Your Experiment

    Type
    Guide
    ...promoter is typically used for gRNA May contain reporter gene (e.g. GFP) to identify and enrich positive...vector or separate transfer vectors May contain reporter gene (e.g. GFP) or selection marker to identify... to target cells through microinjection or electroporation Transient expression of CRISPR components Expression...may alter protein function when they occur in important protein domains. For gene editing experiments ... addition to off-target activity , it is also important to consider factors that maximize cleavage of ...25408407 Hashimoto, M., & Takemoto, T. (2015). Electroporation enables the efficient mRNA delivery into the...facilitates CRISPR/Cas9-based genome editing. Scientific Reports . 5 , 11315. PMID: 26066060 Zuris, J. A., Thompson...

  18. Lentiviral Vector Guide

    Type
    Guide
    ...transcription of the full-length virus after it is incorporated into a host genome. This is often found in second-generation...cells, they kill off any cells that have not incorporated the lentiviral genome and the cells that survive...the only type of selectable marker. Fluorescent reporters, such as GFP, are another common selection marker...interest and contains the sequences that will be incorporated into the host cell genome but cannot produce...after one round of reverse transcription. After incorporation into a host cell, this deletion prevents further... expression of transgenes via increased nuclear export. RRE in cis Rev Response Element; he sequence to...partially spliced transcripts to facilitate nuclear export. Provided by a separate plasmid from gag/pol in...

  19. Chemogenetics Guide

    Type
    Guide
    ...control expression of a chemogenetic reporter ensures that the reporter remains silent until a cell or tissue-specific...ligands can have high potency, which is potentially important for dosing in animal studies, made them attractive...agonists for PSAM4. A given PSAM is coupled with an ion pore domain (IPD) to form ligand-gated ion channels (...signaling. PSAM-based LGICs can be classified by the ion pore domain they are coupled to: PSAM-Gly LGICs pair ... of PSAMs and their activity in neurons PSAM Ion Pore Domain Ligand(s) Effect Outcome (in neurons) Reference...

  20. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...cells, they kill off any cells that have not incorporated the retroviral genome and the cells that survive...the only type of selectable marker. Fluorescent reporters, such as GFP, are another common selection marker...interest and contains the sequences that will be incorporated into the host cell genome but cannot produce...after one round of reverse transcription. After incorporation into a host cell, this deletion prevents further... expression of transgenes via increased nuclear export. Psi (Ѱ) in cis RNA packaging signal; recognized...
Showing: 101 - 120 of 921 results